Mutagenetix > Incidental Mutations

Incidental Mutation 'R7009:Gapvd1'

544874

Institutional Source

Beutler Lab

Gene Symbol

Gapvd1

Ensembl Gene

ENSMUSG00000026867

Gene Name

GTPase activating protein and VPS9 domains 1

Synonyms

4432404J10Rik, 2010005B09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34674594-34755232 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34700817 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 948 (S948P)

Ref Sequence

ENSEMBL: ENSMUSP00000099864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028224
AA Change: S948P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: S948P

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102800
AA Change: S948P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: S948P

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.3e-36	PFAM
internal_repeat_1	626	655	3.27e-5	PROSPERO
low complexity region	664	678	N/A	INTRINSIC
internal_repeat_1	686	717	3.27e-5	PROSPERO
low complexity region	875	890	N/A	INTRINSIC
low complexity region	909	920	N/A	INTRINSIC
low complexity region	923	933	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	972	982	N/A	INTRINSIC
VPS9	1332	1437	1.08e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113099
AA Change: S969P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: S969P

Domain	Start	End	E-Value	Type
Pfam:RasGAP	152	353	2.8e-37	PFAM
internal_repeat_1	647	676	3.6e-5	PROSPERO
low complexity region	685	699	N/A	INTRINSIC
internal_repeat_1	707	738	3.6e-5	PROSPERO
low complexity region	896	911	N/A	INTRINSIC
low complexity region	930	941	N/A	INTRINSIC
low complexity region	944	954	N/A	INTRINSIC
low complexity region	957	973	N/A	INTRINSIC
low complexity region	993	1003	N/A	INTRINSIC
VPS9	1353	1458	1.08e-24	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867
AA Change: S85P

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
low complexity region	47	58	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
VPS9	443	548	1.08e-24	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867
AA Change: S805P

Domain	Start	End	E-Value	Type
Pfam:RasGAP	1	184	4.9e-32	PFAM
internal_repeat_1	484	513	1.18e-5	PROSPERO
low complexity region	522	536	N/A	INTRINSIC
internal_repeat_1	544	575	1.18e-5	PROSPERO
low complexity region	733	748	N/A	INTRINSIC
low complexity region	767	778	N/A	INTRINSIC
low complexity region	781	791	N/A	INTRINSIC
low complexity region	794	810	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: S406P

Domain	Start	End	E-Value	Type
internal_repeat_1	85	114	3.65e-6	PROSPERO
low complexity region	123	137	N/A	INTRINSIC
internal_repeat_1	145	176	3.65e-6	PROSPERO
low complexity region	334	349	N/A	INTRINSIC
low complexity region	368	379	N/A	INTRINSIC
low complexity region	382	392	N/A	INTRINSIC
low complexity region	395	411	N/A	INTRINSIC
low complexity region	431	441	N/A	INTRINSIC
VPS9	791	896	1.08e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128855

SMART Domains

Protein: ENSMUSP00000129138
Gene: ENSMUSG00000026867

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867
AA Change: S805P

Domain	Start	End	E-Value	Type
Pfam:RasGAP	15	216	1.2e-37	PFAM
internal_repeat_1	510	539	1.19e-5	PROSPERO
low complexity region	548	562	N/A	INTRINSIC
internal_repeat_1	570	601	1.19e-5	PROSPERO
low complexity region	733	748	N/A	INTRINSIC
low complexity region	767	778	N/A	INTRINSIC
low complexity region	781	791	N/A	INTRINSIC
low complexity region	794	810	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Gapvd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Gapvd1	APN	2	34699860	missense	probably benign	0.00
IGL00985:Gapvd1	APN	2	34695563	missense	probably damaging	0.99
IGL01133:Gapvd1	APN	2	34725398	missense	probably damaging	0.98
IGL01347:Gapvd1	APN	2	34706696	critical splice donor site	probably null
IGL01830:Gapvd1	APN	2	34688956	missense	probably benign	0.44
IGL01865:Gapvd1	APN	2	34695503	missense	probably null
IGL02009:Gapvd1	APN	2	34704191	missense	probably damaging	1.00
IGL02014:Gapvd1	APN	2	34704191	missense	probably damaging	1.00
IGL02189:Gapvd1	APN	2	34728544	missense	probably damaging	1.00
IGL02418:Gapvd1	APN	2	34730518	missense	probably benign	0.00
IGL02632:Gapvd1	APN	2	34684174	splice site	probably benign
IGL02636:Gapvd1	APN	2	34725404	missense	probably benign	0.01
IGL02643:Gapvd1	APN	2	34704180	missense	probably damaging	1.00
IGL03271:Gapvd1	APN	2	34727207	unclassified	probably benign
P0023:Gapvd1	UTSW	2	34706688	splice site	probably benign
R0016:Gapvd1	UTSW	2	34699913	splice site	probably benign
R0016:Gapvd1	UTSW	2	34699913	splice site	probably benign
R0029:Gapvd1	UTSW	2	34678141	missense	probably damaging	1.00
R0029:Gapvd1	UTSW	2	34678141	missense	probably damaging	1.00
R0282:Gapvd1	UTSW	2	34688960	nonsense	probably null
R0414:Gapvd1	UTSW	2	34693427	missense	probably benign	0.14
R0443:Gapvd1	UTSW	2	34704621	intron	probably benign
R0542:Gapvd1	UTSW	2	34725036	unclassified	probably benign
R0570:Gapvd1	UTSW	2	34728540	missense	probably damaging	1.00
R0840:Gapvd1	UTSW	2	34729113	missense	probably benign	0.29
R0866:Gapvd1	UTSW	2	34709217	missense	probably damaging	1.00
R0890:Gapvd1	UTSW	2	34712317	missense	probably damaging	1.00
R0926:Gapvd1	UTSW	2	34712325	missense	probably damaging	1.00
R0970:Gapvd1	UTSW	2	34730613	unclassified	probably null
R1168:Gapvd1	UTSW	2	34704469	missense	probably damaging	1.00
R1391:Gapvd1	UTSW	2	34706802	missense	probably damaging	1.00
R1577:Gapvd1	UTSW	2	34709228	missense	probably damaging	1.00
R1585:Gapvd1	UTSW	2	34712195	missense	possibly damaging	0.93
R1669:Gapvd1	UTSW	2	34730682	critical splice acceptor site	probably null
R1677:Gapvd1	UTSW	2	34700761	critical splice donor site	probably null
R1812:Gapvd1	UTSW	2	34725064	nonsense	probably null
R1874:Gapvd1	UTSW	2	34706021	missense	probably damaging	1.00
R1878:Gapvd1	UTSW	2	34725200	missense	probably benign	0.00
R1974:Gapvd1	UTSW	2	34700841	missense	probably damaging	0.99
R2111:Gapvd1	UTSW	2	34684317	missense	probably benign	0.08
R2921:Gapvd1	UTSW	2	34688863	missense	probably damaging	0.97
R2923:Gapvd1	UTSW	2	34688863	missense	probably damaging	0.97
R3846:Gapvd1	UTSW	2	34729072	nonsense	probably null
R3894:Gapvd1	UTSW	2	34728476	missense	probably benign	0.23
R4405:Gapvd1	UTSW	2	34728735	missense	probably damaging	1.00
R4605:Gapvd1	UTSW	2	34728537	missense	probably damaging	1.00
R4770:Gapvd1	UTSW	2	34691181	missense	probably damaging	0.98
R4935:Gapvd1	UTSW	2	34704492	nonsense	probably null
R5218:Gapvd1	UTSW	2	34728476	missense	probably benign	0.23
R5490:Gapvd1	UTSW	2	34693433	missense	probably benign	0.23
R5571:Gapvd1	UTSW	2	34715253	missense	probably damaging	1.00
R5588:Gapvd1	UTSW	2	34709154	missense	probably damaging	1.00
R5933:Gapvd1	UTSW	2	34684291	missense	probably benign	0.27
R6117:Gapvd1	UTSW	2	34690459	splice site	probably null
R6661:Gapvd1	UTSW	2	34728438	missense	probably damaging	1.00
R6857:Gapvd1	UTSW	2	34728377	missense	probably damaging	1.00
R6950:Gapvd1	UTSW	2	34684245	missense	probably benign	0.04
R7125:Gapvd1	UTSW	2	34695600	missense	probably benign
R7154:Gapvd1	UTSW	2	34725063	missense	probably damaging	1.00
R7316:Gapvd1	UTSW	2	34704669	missense	probably damaging	1.00
R7358:Gapvd1	UTSW	2	34690461	critical splice donor site	probably null
R7363:Gapvd1	UTSW	2	34712195	missense	probably benign	0.01
R7371:Gapvd1	UTSW	2	34717373	missense	probably benign
R7418:Gapvd1	UTSW	2	34725118	missense	probably benign	0.12
R7690:Gapvd1	UTSW	2	34729122	missense	possibly damaging	0.68
R7740:Gapvd1	UTSW	2	34700822	missense	probably damaging	1.00
R7742:Gapvd1	UTSW	2	34678623	missense	probably damaging	1.00
R7857:Gapvd1	UTSW	2	34729067	missense	probably benign	0.06
R8062:Gapvd1	UTSW	2	34678114	missense	probably benign	0.37
R8113:Gapvd1	UTSW	2	34704318	missense	probably damaging	0.98
R8303:Gapvd1	UTSW	2	34712200	missense	probably damaging	1.00
Z1177:Gapvd1	UTSW	2	34699864	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GGGCCTTTTAAAGCTCTGCC -3'
(R):5'- TCAAATGACCCAGGCTGTCC -3'

Sequencing Primer
(F):5'- TGCCAGAGCATTCATCTCAATG -3'
(R):5'- CCTATTCCAGAGGGTGCCTG -3'

Posted On

2019-05-13