Incidental Mutation 'R7009:Gapvd1'
ID 544874
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene Name GTPase activating protein and VPS9 domains 1
Synonyms 4432404J10Rik, 2010005B09Rik
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 34674594-34755232 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34700817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 948 (S948P)
Ref Sequence ENSEMBL: ENSMUSP00000099864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
AlphaFold Q6PAR5
Predicted Effect probably damaging
Transcript: ENSMUST00000028224
AA Change: S948P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: S948P

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102800
AA Change: S948P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: S948P

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113099
AA Change: S969P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: S969P

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867
AA Change: S85P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867
AA Change: S805P

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: S406P

DomainStartEndE-ValueType
internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128855
SMART Domains Protein: ENSMUSP00000129138
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867
AA Change: S805P

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 (GRCm38) D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 (GRCm38) D69E possibly damaging Het
Abat A C 16: 8,602,367 (GRCm38) M177L probably benign Het
Acadvl A G 11: 70,014,791 (GRCm38) probably null Het
Adam5 T C 8: 24,806,438 (GRCm38) N331S probably benign Het
Ager A G 17: 34,600,736 (GRCm38) E372G probably damaging Het
Angpt1 T A 15: 42,523,595 (GRCm38) Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 (GRCm38) I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 (GRCm38) I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 (GRCm38) Q1131L probably benign Het
Bach1 G A 16: 87,719,291 (GRCm38) R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 (GRCm38) M1K probably null Het
Ccdc18 G A 5: 108,173,862 (GRCm38) probably null Het
Ccdc42 T C 11: 68,594,616 (GRCm38) F267S probably damaging Het
Cdh23 T A 10: 60,337,306 (GRCm38) Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 (GRCm38) S704C probably damaging Het
Cenpe G A 3: 135,235,202 (GRCm38) S704N probably benign Het
Cfap54 A T 10: 92,875,019 (GRCm38) S2727T unknown Het
Clu T A 14: 65,971,832 (GRCm38) V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 (GRCm38) I98V probably benign Het
Copa G T 1: 172,091,000 (GRCm38) R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 (GRCm38) probably null Het
Etnk1 T A 6: 143,203,154 (GRCm38) probably null Het
Fnip1 A T 11: 54,502,935 (GRCm38) K732N probably damaging Het
G6pd2 A G 5: 61,808,891 (GRCm38) E3G probably benign Het
Gal3st2 A G 1: 93,873,759 (GRCm38) T95A probably benign Het
Ggps1 A T 13: 14,054,165 (GRCm38) Y8* probably null Het
Gria2 T C 3: 80,706,972 (GRCm38) E587G probably damaging Het
Hpse T C 5: 100,692,279 (GRCm38) E324G probably benign Het
Il16 G A 7: 83,646,388 (GRCm38) T493I probably benign Het
Ints1 T C 5: 139,768,462 (GRCm38) T652A possibly damaging Het
Ism1 A G 2: 139,757,279 (GRCm38) I391V probably damaging Het
Katnb1 A G 8: 95,098,384 (GRCm38) D598G probably damaging Het
Kif5c A G 2: 49,757,429 (GRCm38) S880G probably benign Het
Klra8 T C 6: 130,125,184 (GRCm38) N96S probably benign Het
Krt79 T A 15: 101,931,441 (GRCm38) D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 (GRCm38) R92Q probably benign Het
Lce1d C A 3: 92,686,046 (GRCm38) C20F unknown Het
Limk1 T C 5: 134,672,699 (GRCm38) T117A probably benign Het
Medag A T 5: 149,427,243 (GRCm38) K61M probably benign Het
Mkrn3 T C 7: 62,419,618 (GRCm38) M142V probably benign Het
Mob3c G A 4: 115,831,582 (GRCm38) R104H probably benign Het
Morc1 G T 16: 48,627,070 (GRCm38) R903L possibly damaging Het
Myh6 T C 14: 54,952,292 (GRCm38) E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 (GRCm38) C434G probably null Het
Npr3 C T 15: 11,905,248 (GRCm38) C131Y probably damaging Het
Oacyl C A 18: 65,722,538 (GRCm38) Y112* probably null Het
Oprl1 A G 2: 181,718,381 (GRCm38) T77A probably damaging Het
Osgep A G 14: 50,924,708 (GRCm38) V24A probably damaging Het
Otx2 T A 14: 48,658,797 (GRCm38) K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 (GRCm38) L922P probably benign Het
Phldb1 A G 9: 44,694,408 (GRCm38) V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 (GRCm38) probably null Het
Psmd3 G A 11: 98,682,766 (GRCm38) D13N probably benign Het
Ptprc G A 1: 138,064,553 (GRCm38) H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 (GRCm38) H291L probably damaging Het
Rasa4 T A 5: 136,101,363 (GRCm38) D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 (GRCm38) silent Het
Rin2 A C 2: 145,883,475 (GRCm38) D794A probably damaging Het
Ripk1 A G 13: 34,030,062 (GRCm38) I522M probably damaging Het
Rnf31 T C 14: 55,592,551 (GRCm38) Y143H probably benign Het
Rp1 T G 1: 4,042,068 (GRCm38) I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 (GRCm38) H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 (GRCm38) V455A probably damaging Het
Runx2 G A 17: 44,814,192 (GRCm38) P80L probably damaging Het
Scn5a T G 9: 119,485,930 (GRCm38) E1904A probably damaging Het
Sec16a G T 2: 26,436,002 (GRCm38) S240* probably null Het
Slc22a8 C T 19: 8,605,417 (GRCm38) T154I probably benign Het
Slc25a16 T A 10: 62,937,454 (GRCm38) V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 (GRCm38) S2T probably benign Het
Srd5a3 G A 5: 76,149,866 (GRCm38) V48I probably benign Het
Srebf1 A C 11: 60,200,526 (GRCm38) H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 (GRCm38) K1310E probably benign Het
Swt1 A G 1: 151,370,630 (GRCm38) V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 (GRCm38) T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 (GRCm38) T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 (GRCm38) probably null Het
Tmem246 A T 4: 49,586,325 (GRCm38) M281K probably benign Het
Trim45 A G 3: 100,931,879 (GRCm38) probably benign Het
Tsen2 T A 6: 115,547,972 (GRCm38) M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 (GRCm38) C715* probably null Het
Vmn2r102 G A 17: 19,694,194 (GRCm38) V674I probably damaging Het
Zfp87 A G 13: 67,517,054 (GRCm38) S430P probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34,699,860 (GRCm38) missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34,695,563 (GRCm38) missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34,725,398 (GRCm38) missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34,706,696 (GRCm38) critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34,688,956 (GRCm38) missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34,695,503 (GRCm38) missense probably null
IGL02009:Gapvd1 APN 2 34,704,191 (GRCm38) missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34,704,191 (GRCm38) missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34,728,544 (GRCm38) missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34,730,518 (GRCm38) missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34,684,174 (GRCm38) splice site probably benign
IGL02636:Gapvd1 APN 2 34,725,404 (GRCm38) missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34,704,180 (GRCm38) missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34,727,207 (GRCm38) unclassified probably benign
P0023:Gapvd1 UTSW 2 34,706,688 (GRCm38) splice site probably benign
R0016:Gapvd1 UTSW 2 34,699,913 (GRCm38) splice site probably benign
R0016:Gapvd1 UTSW 2 34,699,913 (GRCm38) splice site probably benign
R0029:Gapvd1 UTSW 2 34,678,141 (GRCm38) missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34,678,141 (GRCm38) missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34,688,960 (GRCm38) nonsense probably null
R0414:Gapvd1 UTSW 2 34,693,427 (GRCm38) missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34,704,621 (GRCm38) intron probably benign
R0542:Gapvd1 UTSW 2 34,725,036 (GRCm38) unclassified probably benign
R0570:Gapvd1 UTSW 2 34,728,540 (GRCm38) missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34,729,113 (GRCm38) missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34,709,217 (GRCm38) missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34,712,317 (GRCm38) missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34,712,325 (GRCm38) missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34,730,613 (GRCm38) splice site probably null
R1168:Gapvd1 UTSW 2 34,704,469 (GRCm38) missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34,706,802 (GRCm38) missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34,709,228 (GRCm38) missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34,712,195 (GRCm38) missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34,730,682 (GRCm38) critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34,700,761 (GRCm38) critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34,725,064 (GRCm38) nonsense probably null
R1874:Gapvd1 UTSW 2 34,706,021 (GRCm38) missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34,725,200 (GRCm38) missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34,700,841 (GRCm38) missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34,684,317 (GRCm38) missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34,688,863 (GRCm38) missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34,688,863 (GRCm38) missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34,729,072 (GRCm38) nonsense probably null
R3894:Gapvd1 UTSW 2 34,728,476 (GRCm38) missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34,728,735 (GRCm38) missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34,728,537 (GRCm38) missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34,691,181 (GRCm38) missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34,704,492 (GRCm38) nonsense probably null
R5218:Gapvd1 UTSW 2 34,728,476 (GRCm38) missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34,693,433 (GRCm38) missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34,715,253 (GRCm38) missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34,709,154 (GRCm38) missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34,684,291 (GRCm38) missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34,690,459 (GRCm38) splice site probably null
R6661:Gapvd1 UTSW 2 34,728,438 (GRCm38) missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34,728,377 (GRCm38) missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34,684,245 (GRCm38) missense probably benign 0.04
R7125:Gapvd1 UTSW 2 34,695,600 (GRCm38) missense probably benign
R7154:Gapvd1 UTSW 2 34,725,063 (GRCm38) missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34,704,669 (GRCm38) missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34,690,461 (GRCm38) critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34,712,195 (GRCm38) missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34,717,373 (GRCm38) missense probably benign
R7418:Gapvd1 UTSW 2 34,725,118 (GRCm38) missense probably benign 0.12
R7690:Gapvd1 UTSW 2 34,729,122 (GRCm38) missense possibly damaging 0.68
R7740:Gapvd1 UTSW 2 34,700,822 (GRCm38) missense probably damaging 1.00
R7742:Gapvd1 UTSW 2 34,678,623 (GRCm38) missense probably damaging 1.00
R7857:Gapvd1 UTSW 2 34,729,067 (GRCm38) missense probably benign 0.06
R8062:Gapvd1 UTSW 2 34,678,114 (GRCm38) missense probably benign 0.37
R8113:Gapvd1 UTSW 2 34,704,318 (GRCm38) missense probably damaging 0.98
R8303:Gapvd1 UTSW 2 34,712,200 (GRCm38) missense probably damaging 1.00
R8558:Gapvd1 UTSW 2 34,704,481 (GRCm38) missense probably damaging 1.00
R8751:Gapvd1 UTSW 2 34,678,066 (GRCm38) missense probably damaging 0.96
R8781:Gapvd1 UTSW 2 34,720,686 (GRCm38) missense probably benign 0.37
R8794:Gapvd1 UTSW 2 34,704,318 (GRCm38) missense possibly damaging 0.49
R8876:Gapvd1 UTSW 2 34,678,548 (GRCm38) missense possibly damaging 0.95
R8942:Gapvd1 UTSW 2 34,729,122 (GRCm38) missense probably benign 0.06
R8954:Gapvd1 UTSW 2 34,678,098 (GRCm38) missense probably damaging 1.00
R9066:Gapvd1 UTSW 2 34,727,285 (GRCm38) missense probably damaging 1.00
R9428:Gapvd1 UTSW 2 34,717,306 (GRCm38) missense probably damaging 1.00
R9470:Gapvd1 UTSW 2 34,712,268 (GRCm38) missense possibly damaging 0.78
R9505:Gapvd1 UTSW 2 34,723,014 (GRCm38) missense
R9690:Gapvd1 UTSW 2 34,728,480 (GRCm38) missense probably damaging 1.00
Z1177:Gapvd1 UTSW 2 34,699,864 (GRCm38) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGGCCTTTTAAAGCTCTGCC -3'
(R):5'- TCAAATGACCCAGGCTGTCC -3'

Sequencing Primer
(F):5'- TGCCAGAGCATTCATCTCAATG -3'
(R):5'- CCTATTCCAGAGGGTGCCTG -3'
Posted On 2019-05-13