Incidental Mutation 'R7009:Kif5c'
ID 544875
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Name kinesin family member 5C
Synonyms Khc
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 49509310-49664790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49647441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 880 (S880G)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
AlphaFold P28738
PDB Structure Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028102
AA Change: S880G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: S880G

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Morc1 G T 16: 48,447,433 (GRCm39) R903L possibly damaging Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rp1 T G 1: 4,112,291 (GRCm39) I1187L unknown Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Ttc21a T A 9: 119,787,139 (GRCm39) C715* probably null Het
Vmn2r102 G A 17: 19,914,456 (GRCm39) V674I probably damaging Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49,584,828 (GRCm39) missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49,591,089 (GRCm39) missense probably damaging 1.00
IGL01459:Kif5c APN 2 49,625,569 (GRCm39) missense probably benign 0.36
IGL02127:Kif5c APN 2 49,591,122 (GRCm39) splice site probably null
IGL03088:Kif5c APN 2 49,634,455 (GRCm39) missense probably benign 0.01
IGL03379:Kif5c APN 2 49,591,104 (GRCm39) missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49,509,729 (GRCm39) missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49,584,044 (GRCm39) missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49,631,360 (GRCm39) missense probably benign 0.00
R0017:Kif5c UTSW 2 49,622,725 (GRCm39) missense probably benign
R0017:Kif5c UTSW 2 49,622,725 (GRCm39) missense probably benign
R0116:Kif5c UTSW 2 49,642,251 (GRCm39) splice site probably benign
R0550:Kif5c UTSW 2 49,648,924 (GRCm39) missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49,578,765 (GRCm39) missense probably damaging 1.00
R0967:Kif5c UTSW 2 49,588,128 (GRCm39) unclassified probably benign
R1015:Kif5c UTSW 2 49,634,377 (GRCm39) missense probably benign 0.13
R1758:Kif5c UTSW 2 49,613,145 (GRCm39) missense probably benign 0.00
R1786:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R1828:Kif5c UTSW 2 49,570,252 (GRCm39) critical splice donor site probably null
R2130:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R2132:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R2237:Kif5c UTSW 2 49,584,020 (GRCm39) missense probably benign 0.35
R3970:Kif5c UTSW 2 49,578,756 (GRCm39) missense probably damaging 1.00
R4439:Kif5c UTSW 2 49,578,737 (GRCm39) missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49,625,602 (GRCm39) missense probably damaging 0.99
R5318:Kif5c UTSW 2 49,561,840 (GRCm39) missense probably benign
R5345:Kif5c UTSW 2 49,613,078 (GRCm39) missense probably benign
R5490:Kif5c UTSW 2 49,648,870 (GRCm39) missense probably benign
R5496:Kif5c UTSW 2 49,620,202 (GRCm39) missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49,620,211 (GRCm39) missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49,620,211 (GRCm39) missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49,625,521 (GRCm39) missense probably benign 0.09
R6688:Kif5c UTSW 2 49,578,749 (GRCm39) missense probably benign 0.06
R7006:Kif5c UTSW 2 49,625,526 (GRCm39) missense probably damaging 0.97
R7081:Kif5c UTSW 2 49,631,373 (GRCm39) missense probably benign 0.00
R7372:Kif5c UTSW 2 49,648,671 (GRCm39) splice site probably null
R7512:Kif5c UTSW 2 49,590,977 (GRCm39) missense probably damaging 1.00
R7549:Kif5c UTSW 2 49,591,105 (GRCm39) missense probably benign 0.11
R7764:Kif5c UTSW 2 49,639,339 (GRCm39) missense probably damaging 1.00
R7764:Kif5c UTSW 2 49,617,973 (GRCm39) critical splice donor site probably null
R7904:Kif5c UTSW 2 49,591,095 (GRCm39) missense probably damaging 1.00
R8292:Kif5c UTSW 2 49,625,497 (GRCm39) missense probably benign 0.05
R8735:Kif5c UTSW 2 49,584,783 (GRCm39) missense probably damaging 1.00
R8816:Kif5c UTSW 2 49,584,799 (GRCm39) missense probably damaging 1.00
R9109:Kif5c UTSW 2 49,620,151 (GRCm39) missense probably damaging 1.00
R9139:Kif5c UTSW 2 49,620,291 (GRCm39) missense probably benign 0.00
R9257:Kif5c UTSW 2 49,590,604 (GRCm39) nonsense probably null
R9325:Kif5c UTSW 2 49,639,378 (GRCm39) missense probably benign 0.04
R9368:Kif5c UTSW 2 49,622,792 (GRCm39) missense probably damaging 0.99
R9748:Kif5c UTSW 2 49,584,859 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTAGTAGGGTGATGGTCTG -3'
(R):5'- TCCTAGCCTTTCAGGTGAGTG -3'

Sequencing Primer
(F):5'- TCTGGCTGCTCGTCAGG -3'
(R):5'- AGCCTTTCAGGTGAGTGAAATCCC -3'
Posted On 2019-05-13