Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Rin2'

544878

Institutional Source

Beutler Lab

Gene Symbol

Rin2

Ensembl Gene

ENSMUSG00000001768

Gene Name

Ras and Rab interactor 2

Synonyms

RASSF4, 4632403N06Rik, 2010003K16Rik

MMRRC Submission

Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Essential gene?

Possibly non essential (E-score: 0.313) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145675215-145887616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 145883475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 794 (D794A)

Ref Sequence

ENSEMBL: ENSMUSP00000105632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]

AlphaFold

Q9D684

Predicted Effect

probably damaging
Transcript: ENSMUST00000094480
AA Change: D749A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: D749A

Domain	Start	End	E-Value	Type
SH2	50	136	1.38e-3	SMART
low complexity region	175	187	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	375	385	N/A	INTRINSIC
low complexity region	393	411	N/A	INTRINSIC
Blast:SH2	540	576	2e-7	BLAST
VPS9	612	730	1.72e-68	SMART
RA	751	842	3.35e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110005
AA Change: D794A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: D794A

Domain	Start	End	E-Value	Type
SH2	95	181	1.38e-3	SMART
low complexity region	220	232	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	380	397	N/A	INTRINSIC
low complexity region	420	430	N/A	INTRINSIC
low complexity region	438	456	N/A	INTRINSIC
Blast:SH2	585	621	2e-7	BLAST
VPS9	657	775	1.72e-68	SMART
RA	796	887	3.35e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147976

Meta Mutation Damage Score

0.1681

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Rin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02928:Rin2	APN	2	145860006	splice site	probably benign
IGL03222:Rin2	APN	2	145860195	nonsense	probably null
IGL03371:Rin2	APN	2	145885926	utr 3 prime	probably benign
IGL03411:Rin2	APN	2	145860944	missense	probably damaging	0.99
D4043:Rin2	UTSW	2	145822363	missense	possibly damaging	0.61
R0025:Rin2	UTSW	2	145878832	splice site	probably benign
R0110:Rin2	UTSW	2	145861033	missense	probably benign
R0144:Rin2	UTSW	2	145876639	missense	probably damaging	0.96
R0510:Rin2	UTSW	2	145861033	missense	probably benign
R1326:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1327:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1328:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1329:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1330:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1544:Rin2	UTSW	2	145858446	missense	probably damaging	1.00
R1658:Rin2	UTSW	2	145876456	missense	probably benign	0.04
R1832:Rin2	UTSW	2	145861171	missense	possibly damaging	0.48
R1986:Rin2	UTSW	2	145878940	missense	probably damaging	1.00
R2137:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2167:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2170:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2260:Rin2	UTSW	2	145878904	missense	probably damaging	0.97
R2312:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2884:Rin2	UTSW	2	145860991	missense	probably benign	0.07
R3155:Rin2	UTSW	2	145860851	missense	probably benign	0.17
R3771:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3772:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3773:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3822:Rin2	UTSW	2	145822630	missense	probably benign	0.02
R3824:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3825:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3885:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3893:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3939:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3940:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4012:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4019:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4058:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4214:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4231:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4232:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4236:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4372:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4410:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4415:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4471:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4490:Rin2	UTSW	2	145822274	missense	possibly damaging	0.66
R4597:Rin2	UTSW	2	145860905	missense	probably benign	0.01
R5099:Rin2	UTSW	2	145878901	missense	probably damaging	1.00
R5268:Rin2	UTSW	2	145844760	missense	probably benign
R5493:Rin2	UTSW	2	145860709	missense	probably damaging	1.00
R5622:Rin2	UTSW	2	145860379	missense	probably benign	0.07
R5947:Rin2	UTSW	2	145844943	intron	probably benign
R6280:Rin2	UTSW	2	145861019	missense	probably damaging	1.00
R7531:Rin2	UTSW	2	145858499	missense	probably benign
R7824:Rin2	UTSW	2	145861117	missense	probably benign	0.00
R8065:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8067:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8144:Rin2	UTSW	2	145822305	missense	probably benign
R8510:Rin2	UTSW	2	145885691	missense	probably damaging	1.00
R8853:Rin2	UTSW	2	145876555	missense	possibly damaging	0.68
R8880:Rin2	UTSW	2	145848852	missense	probably damaging	1.00
R9224:Rin2	UTSW	2	145878902	nonsense	probably null
R9325:Rin2	UTSW	2	145885899	missense	probably benign	0.15
R9417:Rin2	UTSW	2	145844793	missense	probably benign	0.02
R9555:Rin2	UTSW	2	145876495	nonsense	probably null
R9631:Rin2	UTSW	2	145876517	missense	probably damaging	1.00
R9667:Rin2	UTSW	2	145860282	missense	possibly damaging	0.89
R9691:Rin2	UTSW	2	145848844	missense	probably damaging	0.97
R9727:Rin2	UTSW	2	145860586	missense	possibly damaging	0.94
R9780:Rin2	UTSW	2	145876631	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTGACACTCCTAAGGACC -3'
(R):5'- TTTGAAAGTCGAGGTGCATCTG -3'

Sequencing Primer
(F):5'- GTGACACTCCTAAGGACCCATTTTC -3'
(R):5'- CTGTGTACACGTCTAAAGACACTGG -3'

Posted On

2019-05-13