Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Hpse'

544891

Institutional Source

Beutler Lab

Gene Symbol

Hpse

Ensembl Gene

ENSMUSG00000035273

Gene Name

heparanase

Synonyms

Hpa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100679484-100719716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100692279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 324 (E324G)

Ref Sequence

ENSEMBL: ENSMUSP00000108529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]

AlphaFold

Q6YGZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000045617
AA Change: E324G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: E324G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Glyco_hydro_79n	132	362	1.8e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112908
AA Change: E324G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: E324G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Glyco_hydro_79n	144	362	1.2e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Hpse

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Hpse	APN	5	100691330	missense	possibly damaging	0.89
IGL00743:Hpse	APN	5	100698999	missense	probably benign	0.01
IGL02377:Hpse	APN	5	100691333	missense	probably damaging	1.00
R0082:Hpse	UTSW	5	100692262	missense	possibly damaging	0.93
R0194:Hpse	UTSW	5	100719512	missense	probably benign
R1974:Hpse	UTSW	5	100692238	missense	probably damaging	1.00
R2065:Hpse	UTSW	5	100698931	missense	probably damaging	1.00
R2152:Hpse	UTSW	5	100691403	nonsense	probably null
R2405:Hpse	UTSW	5	100708771	missense	possibly damaging	0.78
R3791:Hpse	UTSW	5	100692238	missense	probably damaging	1.00
R5127:Hpse	UTSW	5	100719537	missense	unknown
R5147:Hpse	UTSW	5	100719509	missense	probably benign	0.00
R5385:Hpse	UTSW	5	100708724	nonsense	probably null
R6446:Hpse	UTSW	5	100695569	nonsense	probably null
R7186:Hpse	UTSW	5	100695529	missense	probably damaging	1.00
R7681:Hpse	UTSW	5	100691391	missense	possibly damaging	0.94
R7964:Hpse	UTSW	5	100698911	critical splice donor site	probably null
R8064:Hpse	UTSW	5	100688900	missense	probably benign	0.00
R8183:Hpse	UTSW	5	100685118	missense	probably damaging	1.00
R8268:Hpse	UTSW	5	100699041	missense	probably damaging	1.00
R8830:Hpse	UTSW	5	100695586	missense	probably benign	0.12
R8845:Hpse	UTSW	5	100711382	missense	probably benign
R8932:Hpse	UTSW	5	100699006	missense	possibly damaging	0.84
R8998:Hpse	UTSW	5	100692243	missense	probably damaging	1.00
R9731:Hpse	UTSW	5	100694156	missense	probably damaging	1.00
X0022:Hpse	UTSW	5	100691378	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGAGACTGTACTTGATGC -3'
(R):5'- CTAATGGCCTATCAGTGGAGTTAAC -3'

Sequencing Primer
(F):5'- AGACTGTACTTGATGCGGGTTTG -3'
(R):5'- AGACCATATTTATTCGTCCTCCTTC -3'

Posted On

2019-05-13