Incidental Mutation 'R7009:Rasa4'
ID 544894
Institutional Source Beutler Lab
Gene Symbol Rasa4
Ensembl Gene ENSMUSG00000004952
Gene Name RAS p21 protein activator 4
Synonyms
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 136112770-136140714 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136130217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 324 (D324E)
Ref Sequence ENSEMBL: ENSMUSP00000098136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042135] [ENSMUST00000100570]
AlphaFold Q6PFQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000042135
AA Change: D324E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037869
Gene: ENSMUSG00000004952
AA Change: D324E

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 604 3.47e-139 SMART
PH 566 674 1.81e-11 SMART
BTK 674 710 3.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100570
AA Change: D324E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098136
Gene: ENSMUSG00000004952
AA Change: D324E

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 558 3.48e-89 SMART
PH 520 628 1.81e-11 SMART
BTK 628 664 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122887
SMART Domains Protein: ENSMUSP00000118929
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
PH 6 103 1.36e-6 SMART
BTK 103 141 5.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140972
Predicted Effect probably benign
Transcript: ENSMUST00000145294
SMART Domains Protein: ENSMUSP00000120203
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
C2 5 68 1.88e-2 SMART
Blast:RasGAP 80 121 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157563
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an increased sensitivity to bacterial infections which involves reduced phagocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Kif5c A G 2: 49,647,441 (GRCm39) S880G probably benign Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Morc1 G T 16: 48,447,433 (GRCm39) R903L possibly damaging Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rp1 T G 1: 4,112,291 (GRCm39) I1187L unknown Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Ttc21a T A 9: 119,787,139 (GRCm39) C715* probably null Het
Vmn2r102 G A 17: 19,914,456 (GRCm39) V674I probably damaging Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Rasa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rasa4 APN 5 136,130,847 (GRCm39) missense possibly damaging 0.95
IGL01364:Rasa4 APN 5 136,124,425 (GRCm39) missense possibly damaging 0.83
IGL01835:Rasa4 APN 5 136,131,461 (GRCm39) missense possibly damaging 0.95
IGL02284:Rasa4 APN 5 136,130,545 (GRCm39) critical splice donor site probably null
IGL02332:Rasa4 APN 5 136,124,453 (GRCm39) missense probably benign 0.02
IGL03197:Rasa4 APN 5 136,130,866 (GRCm39) missense probably damaging 1.00
R0729:Rasa4 UTSW 5 136,130,924 (GRCm39) splice site probably benign
R0782:Rasa4 UTSW 5 136,133,386 (GRCm39) missense possibly damaging 0.94
R1124:Rasa4 UTSW 5 136,134,510 (GRCm39) missense probably benign 0.07
R1673:Rasa4 UTSW 5 136,133,491 (GRCm39) missense probably benign 0.12
R1902:Rasa4 UTSW 5 136,120,092 (GRCm39) missense probably benign 0.01
R2357:Rasa4 UTSW 5 136,120,101 (GRCm39) missense probably damaging 1.00
R2427:Rasa4 UTSW 5 136,130,881 (GRCm39) missense probably benign 0.24
R2880:Rasa4 UTSW 5 136,120,625 (GRCm39) missense probably damaging 1.00
R3818:Rasa4 UTSW 5 136,131,147 (GRCm39) missense possibly damaging 0.65
R4647:Rasa4 UTSW 5 136,130,217 (GRCm39) missense probably damaging 1.00
R4782:Rasa4 UTSW 5 136,120,083 (GRCm39) nonsense probably null
R4837:Rasa4 UTSW 5 136,120,664 (GRCm39) critical splice donor site probably null
R4863:Rasa4 UTSW 5 136,132,765 (GRCm39) nonsense probably null
R5020:Rasa4 UTSW 5 136,130,153 (GRCm39) missense probably damaging 1.00
R5729:Rasa4 UTSW 5 136,122,016 (GRCm39) missense probably benign
R6606:Rasa4 UTSW 5 136,132,801 (GRCm39) missense probably damaging 1.00
R6750:Rasa4 UTSW 5 136,129,802 (GRCm39) missense probably benign 0.12
R7158:Rasa4 UTSW 5 136,130,875 (GRCm39) missense probably damaging 0.99
R7358:Rasa4 UTSW 5 136,124,448 (GRCm39) missense probably benign 0.03
R7914:Rasa4 UTSW 5 136,130,510 (GRCm39) unclassified probably benign
R8303:Rasa4 UTSW 5 136,118,235 (GRCm39) missense possibly damaging 0.95
R8906:Rasa4 UTSW 5 136,133,446 (GRCm39) missense probably benign 0.43
R9138:Rasa4 UTSW 5 136,131,455 (GRCm39) missense possibly damaging 0.60
R9397:Rasa4 UTSW 5 136,129,836 (GRCm39) missense possibly damaging 0.68
R9614:Rasa4 UTSW 5 136,140,343 (GRCm39) missense possibly damaging 0.94
R9652:Rasa4 UTSW 5 136,130,494 (GRCm39) missense probably damaging 1.00
R9685:Rasa4 UTSW 5 136,124,383 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCCTGGGGAGCTTTAAGTTC -3'
(R):5'- AATTCTAGTGGGCAGGGGAC -3'

Sequencing Primer
(F):5'- CTCTGTGGGTCTGAGCATTCC -3'
(R):5'- GGAGTCTTTAGCCCCTCAGTAAATG -3'
Posted On 2019-05-13