Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Ints1'

544896

Institutional Source

Beutler Lab

Gene Symbol

Ints1

Ensembl Gene

ENSMUSG00000029547

Gene Name

integrator complex subunit 1

Synonyms

1110015K06Rik

MMRRC Submission

Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139751282-139775674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139768462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 652 (T652A)

Ref Sequence

ENSEMBL: ENSMUSP00000143789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000196864] [ENSMUST00000200393]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: T650A

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	88	102	N/A	INTRINSIC
Pfam:DUF3677	379	459	6.4e-37	PFAM
low complexity region	854	865	N/A	INTRINSIC
low complexity region	870	876	N/A	INTRINSIC
low complexity region	946	962	N/A	INTRINSIC
low complexity region	965	988	N/A	INTRINSIC
low complexity region	1034	1045	N/A	INTRINSIC
low complexity region	1058	1069	N/A	INTRINSIC
low complexity region	1347	1361	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1615	1624	N/A	INTRINSIC
low complexity region	1763	1776	N/A	INTRINSIC
low complexity region	1840	1855	N/A	INTRINSIC
low complexity region	2062	2076	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196864

SMART Domains

Protein: ENSMUSP00000142362
Gene: ENSMUSG00000029547

Domain	Start	End	E-Value	Type
low complexity region	61	75	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200393
AA Change: T652A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: T652A

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	88	102	N/A	INTRINSIC
Pfam:DUF3677	379	459	6.4e-37	PFAM
low complexity region	854	865	N/A	INTRINSIC
low complexity region	870	876	N/A	INTRINSIC
low complexity region	946	962	N/A	INTRINSIC
low complexity region	965	988	N/A	INTRINSIC
low complexity region	1034	1045	N/A	INTRINSIC
low complexity region	1058	1069	N/A	INTRINSIC
low complexity region	1347	1361	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1615	1624	N/A	INTRINSIC
low complexity region	1763	1776	N/A	INTRINSIC
low complexity region	1840	1855	N/A	INTRINSIC
low complexity region	2062	2076	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Ints1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01116:Ints1	APN	5	139771682	missense	probably damaging	0.99
IGL01329:Ints1	APN	5	139767503	splice site	probably benign
IGL01414:Ints1	APN	5	139758498	missense	probably benign
IGL01612:Ints1	APN	5	139756292	missense	probably benign	0.17
IGL01726:Ints1	APN	5	139768411	splice site	probably benign
IGL01958:Ints1	APN	5	139760088	missense	possibly damaging	0.94
IGL02122:Ints1	APN	5	139765150	nonsense	probably null
IGL02149:Ints1	APN	5	139751960	missense	probably damaging	1.00
IGL02349:Ints1	APN	5	139768468	missense	probably damaging	0.96
IGL02557:Ints1	APN	5	139771637	missense	probably damaging	1.00
IGL02814:Ints1	APN	5	139772391	missense	possibly damaging	0.80
IGL02815:Ints1	APN	5	139755282	missense	probably damaging	0.96
IGL02825:Ints1	APN	5	139764739	missense	probably benign	0.32
IGL03000:Ints1	APN	5	139766506	missense	probably benign	0.01
IGL03164:Ints1	APN	5	139752735	missense	probably damaging	0.99
forgiving	UTSW	5	139767828	missense	probably damaging	0.99
restrained	UTSW	5	139767726	missense	possibly damaging	0.68
A9681:Ints1	UTSW	5	139770139	missense	possibly damaging	0.56
R0113:Ints1	UTSW	5	139765213	missense
R0193:Ints1	UTSW	5	139751730	missense	probably damaging	1.00
R0372:Ints1	UTSW	5	139772438	missense	probably damaging	1.00
R1129:Ints1	UTSW	5	139758471	missense	probably benign	0.00
R1290:Ints1	UTSW	5	139771410	nonsense	probably null
R1313:Ints1	UTSW	5	139762906	missense	probably benign
R1313:Ints1	UTSW	5	139762906	missense	probably benign
R1691:Ints1	UTSW	5	139768932	missense	probably damaging	1.00
R1708:Ints1	UTSW	5	139762839	missense	probably damaging	1.00
R1791:Ints1	UTSW	5	139774522	missense	probably benign	0.04
R2066:Ints1	UTSW	5	139767496	missense	probably benign	0.14
R2102:Ints1	UTSW	5	139755999	missense	possibly damaging	0.50
R2108:Ints1	UTSW	5	139767750	missense	probably damaging	1.00
R2238:Ints1	UTSW	5	139765200	missense	possibly damaging	0.95
R2426:Ints1	UTSW	5	139771814	critical splice donor site	probably null
R2913:Ints1	UTSW	5	139757913	missense	possibly damaging	0.91
R3896:Ints1	UTSW	5	139757644	nonsense	probably null
R4608:Ints1	UTSW	5	139759844	missense	probably benign	0.13
R4658:Ints1	UTSW	5	139774299	missense	possibly damaging	0.88
R4797:Ints1	UTSW	5	139771876	missense	possibly damaging	0.85
R4887:Ints1	UTSW	5	139771156	missense	possibly damaging	0.66
R4944:Ints1	UTSW	5	139758092	splice site	probably null
R4956:Ints1	UTSW	5	139757130	missense	probably damaging	1.00
R4976:Ints1	UTSW	5	139752811	missense	probably damaging	1.00
R5283:Ints1	UTSW	5	139764382	missense	probably damaging	1.00
R5354:Ints1	UTSW	5	139766428	critical splice donor site	probably null
R5496:Ints1	UTSW	5	139755198	missense	probably benign	0.07
R5517:Ints1	UTSW	5	139752787	missense	possibly damaging	0.86
R5696:Ints1	UTSW	5	139754989	missense	probably benign	0.00
R5766:Ints1	UTSW	5	139772145	missense	probably benign	0.33
R6359:Ints1	UTSW	5	139756217	missense	probably benign	0.09
R6753:Ints1	UTSW	5	139765175	missense	probably damaging	1.00
R6892:Ints1	UTSW	5	139767828	missense	probably damaging	0.99
R7047:Ints1	UTSW	5	139758471	nonsense	probably null
R7216:Ints1	UTSW	5	139768984	missense	possibly damaging	0.91
R7220:Ints1	UTSW	5	139762073	missense	possibly damaging	0.91
R7263:Ints1	UTSW	5	139764079	missense	possibly damaging	0.50
R7291:Ints1	UTSW	5	139765074	missense	probably damaging	1.00
R7319:Ints1	UTSW	5	139760765	missense	probably damaging	1.00
R7411:Ints1	UTSW	5	139764260	missense	possibly damaging	0.54
R7497:Ints1	UTSW	5	139768976	missense	probably damaging	0.99
R7529:Ints1	UTSW	5	139767726	missense	possibly damaging	0.68
R7710:Ints1	UTSW	5	139771085	missense	probably benign	0.17
R7816:Ints1	UTSW	5	139771379	missense	possibly damaging	0.90
R7819:Ints1	UTSW	5	139760767	missense	probably damaging	1.00
R7992:Ints1	UTSW	5	139756527	missense	probably damaging	1.00
R8260:Ints1	UTSW	5	139765213	missense
R8265:Ints1	UTSW	5	139772164	missense	probably damaging	1.00
R8782:Ints1	UTSW	5	139759197	missense	probably benign	0.28
R9016:Ints1	UTSW	5	139758571	missense	probably benign
R9053:Ints1	UTSW	5	139762067	missense	possibly damaging	0.55
R9056:Ints1	UTSW	5	139774286	critical splice donor site	probably null
R9080:Ints1	UTSW	5	139753545	missense	probably benign	0.00
R9086:Ints1	UTSW	5	139758192	missense	probably benign
R9122:Ints1	UTSW	5	139760175	missense	possibly damaging	0.83
R9134:Ints1	UTSW	5	139757596	missense	probably benign
R9135:Ints1	UTSW	5	139751946	missense	possibly damaging	0.49
R9169:Ints1	UTSW	5	139762831	missense	probably benign
R9280:Ints1	UTSW	5	139764714	missense	probably damaging	1.00
R9458:Ints1	UTSW	5	139757652	missense	probably damaging	1.00
R9666:Ints1	UTSW	5	139762462	missense	probably benign	0.00
Z1177:Ints1	UTSW	5	139771638	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- CAGCAGTGTCTAGCAGCTAG -3'
(R):5'- CTCTCTTGGTCACTAGTGGC -3'

Sequencing Primer
(F):5'- TGGAGAGGCCATGTCTCAG -3'
(R):5'- CTTTTGCCCAAATGGTCC -3'

Posted On

2019-05-13