Incidental Mutation 'R7009:Ints1'
ID 544896
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Name integrator complex subunit 1
Synonyms 1110015K06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 139751282-139775674 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139768462 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 652 (T652A)
Ref Sequence ENSEMBL: ENSMUSP00000143789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000196864] [ENSMUST00000200393]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: T650A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196864
SMART Domains Protein: ENSMUSP00000142362
Gene: ENSMUSG00000029547

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200393
AA Change: T652A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: T652A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
forgiving UTSW 5 139767828 missense probably damaging 0.99
restrained UTSW 5 139767726 missense possibly damaging 0.68
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0113:Ints1 UTSW 5 139765213 missense
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2238:Ints1 UTSW 5 139765200 missense possibly damaging 0.95
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6753:Ints1 UTSW 5 139765175 missense probably damaging 1.00
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7047:Ints1 UTSW 5 139758471 nonsense probably null
R7216:Ints1 UTSW 5 139768984 missense possibly damaging 0.91
R7220:Ints1 UTSW 5 139762073 missense possibly damaging 0.91
R7263:Ints1 UTSW 5 139764079 missense possibly damaging 0.50
R7291:Ints1 UTSW 5 139765074 missense probably damaging 1.00
R7319:Ints1 UTSW 5 139760765 missense probably damaging 1.00
R7411:Ints1 UTSW 5 139764260 missense possibly damaging 0.54
R7497:Ints1 UTSW 5 139768976 missense probably damaging 0.99
R7529:Ints1 UTSW 5 139767726 missense possibly damaging 0.68
R7710:Ints1 UTSW 5 139771085 missense probably benign 0.17
R7816:Ints1 UTSW 5 139771379 missense possibly damaging 0.90
R7819:Ints1 UTSW 5 139760767 missense probably damaging 1.00
R7992:Ints1 UTSW 5 139756527 missense probably damaging 1.00
R8260:Ints1 UTSW 5 139765213 missense
R8265:Ints1 UTSW 5 139772164 missense probably damaging 1.00
R8782:Ints1 UTSW 5 139759197 missense probably benign 0.28
R9016:Ints1 UTSW 5 139758571 missense probably benign
R9053:Ints1 UTSW 5 139762067 missense possibly damaging 0.55
R9056:Ints1 UTSW 5 139774286 critical splice donor site probably null
R9080:Ints1 UTSW 5 139753545 missense probably benign 0.00
R9086:Ints1 UTSW 5 139758192 missense probably benign
R9122:Ints1 UTSW 5 139760175 missense possibly damaging 0.83
R9134:Ints1 UTSW 5 139757596 missense probably benign
R9135:Ints1 UTSW 5 139751946 missense possibly damaging 0.49
R9169:Ints1 UTSW 5 139762831 missense probably benign
R9280:Ints1 UTSW 5 139764714 missense probably damaging 1.00
R9458:Ints1 UTSW 5 139757652 missense probably damaging 1.00
R9666:Ints1 UTSW 5 139762462 missense probably benign 0.00
Z1177:Ints1 UTSW 5 139771638 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGCAGTGTCTAGCAGCTAG -3'
(R):5'- CTCTCTTGGTCACTAGTGGC -3'

Sequencing Primer
(F):5'- TGGAGAGGCCATGTCTCAG -3'
(R):5'- CTTTTGCCCAAATGGTCC -3'
Posted On 2019-05-13