Incidental Mutation 'R7009:Etnk1'
ID544900
Institutional Source Beutler Lab
Gene Symbol Etnk1
Ensembl Gene ENSMUSG00000030275
Gene Nameethanolamine kinase 1
SynonymsEKI1, D6Ertd3e, 4930555L11Rik, 1110061E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location143167221-143232307 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 143203154 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032413] [ENSMUST00000204947] [ENSMUST00000205256]
Predicted Effect probably null
Transcript: ENSMUST00000032413
SMART Domains Protein: ENSMUSP00000032413
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 1.8e-16 PFAM
Pfam:Choline_kinase 71 276 2.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204947
SMART Domains Protein: ENSMUSP00000145041
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 2.3e-14 PFAM
Pfam:Choline_kinase 71 276 2.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205256
SMART Domains Protein: ENSMUSP00000144903
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 1.7e-14 PFAM
Pfam:Choline_kinase 71 276 2.1e-61 PFAM
Pfam:EcKinase 184 260 3e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Etnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Etnk1 APN 6 143180666 missense probably damaging 1.00
R0415:Etnk1 UTSW 6 143180774 missense probably damaging 1.00
R0928:Etnk1 UTSW 6 143184703 missense probably benign 0.00
R1542:Etnk1 UTSW 6 143180641 missense probably benign 0.00
R4648:Etnk1 UTSW 6 143195274 missense probably damaging 1.00
R4744:Etnk1 UTSW 6 143186593 missense probably damaging 1.00
R4823:Etnk1 UTSW 6 143167638 critical splice donor site probably null
R5039:Etnk1 UTSW 6 143195317 critical splice donor site probably null
R5909:Etnk1 UTSW 6 143197438 missense probably benign 0.02
R6207:Etnk1 UTSW 6 143180798 missense probably damaging 0.99
R6743:Etnk1 UTSW 6 143180617 missense possibly damaging 0.68
X0026:Etnk1 UTSW 6 143180726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATCAGTGTTGACCCTG -3'
(R):5'- CGCATACCTAGTGGGGAAAG -3'

Sequencing Primer
(F):5'- GTCATCAGTGTTGACCCTGTAATTAC -3'
(R):5'- AGAGTCAGAGCTGCCCTGAG -3'
Posted On2019-05-13