Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Il16'

544902

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

045111-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 83646388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 493 (T493I)

Ref Sequence

ENSEMBL: ENSMUSP00000146496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000075418] [ENSMUST00000117410] [ENSMUST00000145610]

AlphaFold

O54824

Predicted Effect

probably benign
Transcript: ENSMUST00000001792
AA Change: T1191I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: T1191I

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075418

SMART Domains

Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
START	7	210	8.57e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145610
AA Change: T493I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
R9651:Il16	UTSW	7	83682856	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCACCAAGCATGCTAGGAAG -3'
(R):5'- CACAGAGTGTTTCCAAATGGGC -3'

Sequencing Primer
(F):5'- CTAGGAAGCTGTGATATGTGAACCAC -3'
(R):5'- TCCAAATGGGCTGGCTTC -3'

Posted On

2019-05-13