Incidental Mutation 'R7009:Il16'
ID544902
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Nameinterleukin 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83642825-83745726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83646388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 493 (T493I)
Ref Sequence ENSEMBL: ENSMUSP00000146496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000075418] [ENSMUST00000117410] [ENSMUST00000145610]
Predicted Effect probably benign
Transcript: ENSMUST00000001792
AA Change: T1191I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: T1191I

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075418
SMART Domains Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

DomainStartEndE-ValueType
START 7 210 8.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117410
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145610
AA Change: T493I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83652458 missense probably benign 0.02
IGL01743:Il16 APN 7 83652299 missense probably benign 0.00
IGL01770:Il16 APN 7 83673026 splice site probably benign
IGL02025:Il16 APN 7 83652848 missense probably damaging 1.00
IGL02317:Il16 APN 7 83666889 missense probably damaging 1.00
IGL02412:Il16 APN 7 83652691 missense probably benign 0.03
IGL02550:Il16 APN 7 83674496 missense possibly damaging 0.90
IGL02568:Il16 APN 7 83661276 missense probably damaging 1.00
IGL02578:Il16 APN 7 83677986 critical splice donor site probably null
IGL02815:Il16 APN 7 83651041 missense probably damaging 0.98
IGL03157:Il16 APN 7 83722403 missense probably damaging 1.00
IGL03161:Il16 APN 7 83722499 missense probably damaging 1.00
IGL03188:Il16 APN 7 83688163 missense probably benign 0.00
IGL03213:Il16 APN 7 83646500 missense probably damaging 1.00
IGL03274:Il16 APN 7 83661234 missense probably damaging 1.00
R0201:Il16 UTSW 7 83722308 missense probably damaging 0.99
R0309:Il16 UTSW 7 83722554 missense probably damaging 1.00
R0597:Il16 UTSW 7 83677975 splice site probably benign
R0942:Il16 UTSW 7 83663141 missense probably benign 0.01
R1018:Il16 UTSW 7 83674538 missense probably damaging 1.00
R1434:Il16 UTSW 7 83655312 missense probably benign
R1715:Il16 UTSW 7 83648728 missense probably benign 0.01
R2179:Il16 UTSW 7 83688079 splice site probably null
R2520:Il16 UTSW 7 83651994 missense probably benign 0.03
R3425:Il16 UTSW 7 83644040 missense probably damaging 1.00
R3761:Il16 UTSW 7 83650885 missense possibly damaging 0.96
R3943:Il16 UTSW 7 83652015 missense probably damaging 0.97
R4470:Il16 UTSW 7 83650838 intron probably benign
R4530:Il16 UTSW 7 83681310 intron probably benign
R4583:Il16 UTSW 7 83682899 missense probably damaging 1.00
R4777:Il16 UTSW 7 83650896 missense probably benign 0.14
R4874:Il16 UTSW 7 83660945 missense possibly damaging 0.56
R4876:Il16 UTSW 7 83673094 missense probably benign
R5677:Il16 UTSW 7 83674553 missense probably damaging 1.00
R5686:Il16 UTSW 7 83648728 missense probably benign 0.36
R5920:Il16 UTSW 7 83652344 missense probably benign 0.03
R6115:Il16 UTSW 7 83652567 nonsense probably null
R6459:Il16 UTSW 7 83722321 missense probably damaging 1.00
R6459:Il16 UTSW 7 83722328 missense probably damaging 1.00
R6601:Il16 UTSW 7 83722469 missense probably damaging 1.00
R6616:Il16 UTSW 7 83646476 missense probably benign 0.37
R6642:Il16 UTSW 7 83688127 missense probably benign 0.03
R6721:Il16 UTSW 7 83663062 critical splice donor site probably null
R7144:Il16 UTSW 7 83646451 missense probably damaging 0.97
R7346:Il16 UTSW 7 83644041 missense probably damaging 1.00
R7403:Il16 UTSW 7 83670135 missense probably damaging 1.00
R7499:Il16 UTSW 7 83674494 missense probably damaging 0.99
R7814:Il16 UTSW 7 83670140 missense possibly damaging 0.46
R8098:Il16 UTSW 7 83646559 missense probably damaging 1.00
R8317:Il16 UTSW 7 83655330 missense probably benign
Z1176:Il16 UTSW 7 83652827 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCACCAAGCATGCTAGGAAG -3'
(R):5'- CACAGAGTGTTTCCAAATGGGC -3'

Sequencing Primer
(F):5'- CTAGGAAGCTGTGATATGTGAACCAC -3'
(R):5'- TCCAAATGGGCTGGCTTC -3'
Posted On2019-05-13