Incidental Mutation 'R7009:Phldb1'
ID544907
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Namepleckstrin homology like domain, family B, member 1
SynonymsLL5A, D330037A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7009 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44686304-44735198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44694408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 375 (V375A)
Ref Sequence ENSEMBL: ENSMUSP00000120023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123310] [ENSMUST00000134465] [ENSMUST00000135436] [ENSMUST00000138356] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000154723] [ENSMUST00000156918]
Predicted Effect probably damaging
Transcript: ENSMUST00000034611
AA Change: V1251A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: V1251A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123310
SMART Domains Protein: ENSMUSP00000122374
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 185 193 N/A INTRINSIC
coiled coil region 232 259 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: V711A

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134465
AA Change: V1204A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: V1204A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135436
AA Change: V375A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537
AA Change: V375A

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138356
AA Change: V1318A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: V1318A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144251
AA Change: V564A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: V564A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147495
AA Change: V1251A

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: V1251A

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: V1010A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154723
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156918
AA Change: V521A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44711146 critical splice donor site probably null
IGL01089:Phldb1 APN 9 44707887 nonsense probably null
IGL01374:Phldb1 APN 9 44696167 missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44718357 splice site probably null
IGL02148:Phldb1 APN 9 44696072 missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44715906 missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44700950 missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44715403 missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44716474 missense probably benign 0.00
IGL02471:Phldb1 APN 9 44711233 missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44710926 missense probably benign 0.00
IGL03335:Phldb1 APN 9 44728069 missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44715960 missense probably benign 0.00
R0070:Phldb1 UTSW 9 44707904 missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44711706 start codon destroyed probably null
R0344:Phldb1 UTSW 9 44701667 missense probably benign 0.14
R0364:Phldb1 UTSW 9 44699335 splice site probably benign
R0622:Phldb1 UTSW 9 44715852 missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44699636 missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44716633 missense probably benign 0.17
R1498:Phldb1 UTSW 9 44701618 missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44718322 missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44715433 missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44715420 missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44715748 missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44716545 missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44728036 missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44707979 missense probably damaging 1.00
R2208:Phldb1 UTSW 9 44696131 missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44726025 missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44718288 missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44694394 missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44715831 missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44711027 missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44696092 missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44704158 missense probably benign 0.04
R5651:Phldb1 UTSW 9 44711903 missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44711651 missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44696117 missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44696140 missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44696143 missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44711900 missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44699568 missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44716062 missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44694424 missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44696135 missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44711904 missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44694047 missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44715372 missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44711161 missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44716462 missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44697946 missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44687677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGCTAGCACTGAAAAG -3'
(R):5'- CATTGGTCTTTCGATGCAGG -3'

Sequencing Primer
(F):5'- CCTGGCTAGCACTGAAAAGTACTG -3'
(R):5'- TCGATGCAGGGTCTTGAGAAG -3'
Posted On2019-05-13