Incidental Mutation 'R7009:Ttc21a'
ID 544911
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Name tetratricopeptide repeat domain 21A
Synonyms Thm2, 4921538N17Rik
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119766672-119796859 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 119787139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 715 (C715*)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
AlphaFold Q8C0S4
Predicted Effect probably null
Transcript: ENSMUST00000035100
AA Change: C715*
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: C715*

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Kif5c A G 2: 49,647,441 (GRCm39) S880G probably benign Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Morc1 G T 16: 48,447,433 (GRCm39) R903L possibly damaging Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rp1 T G 1: 4,112,291 (GRCm39) I1187L unknown Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Vmn2r102 G A 17: 19,914,456 (GRCm39) V674I probably damaging Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119,794,885 (GRCm39) missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119,787,182 (GRCm39) missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119,785,989 (GRCm39) missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119,779,901 (GRCm39) nonsense probably null
IGL02252:Ttc21a APN 9 119,785,994 (GRCm39) missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119,787,347 (GRCm39) missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119,771,642 (GRCm39) missense probably benign 0.01
IGL03155:Ttc21a APN 9 119,773,042 (GRCm39) critical splice donor site probably null
IGL03323:Ttc21a APN 9 119,769,602 (GRCm39) intron probably benign
R0054:Ttc21a UTSW 9 119,773,006 (GRCm39) missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119,783,628 (GRCm39) missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119,768,220 (GRCm39) intron probably benign
R0541:Ttc21a UTSW 9 119,785,892 (GRCm39) intron probably benign
R0545:Ttc21a UTSW 9 119,787,865 (GRCm39) missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119,790,908 (GRCm39) missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119,783,718 (GRCm39) missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119,783,327 (GRCm39) missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119,771,707 (GRCm39) missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119,786,013 (GRCm39) missense probably benign 0.00
R1631:Ttc21a UTSW 9 119,783,228 (GRCm39) splice site probably null
R1905:Ttc21a UTSW 9 119,795,823 (GRCm39) missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119,793,361 (GRCm39) missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119,769,527 (GRCm39) missense probably benign 0.01
R2265:Ttc21a UTSW 9 119,788,074 (GRCm39) missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119,795,189 (GRCm39) missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119,770,331 (GRCm39) missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119,781,320 (GRCm39) missense probably benign 0.02
R3792:Ttc21a UTSW 9 119,783,231 (GRCm39) missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119,779,882 (GRCm39) intron probably benign
R4232:Ttc21a UTSW 9 119,771,684 (GRCm39) missense probably benign 0.00
R4492:Ttc21a UTSW 9 119,770,346 (GRCm39) missense probably benign 0.00
R4498:Ttc21a UTSW 9 119,787,885 (GRCm39) missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119,790,828 (GRCm39) missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119,788,103 (GRCm39) missense probably benign
R4960:Ttc21a UTSW 9 119,774,067 (GRCm39) missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119,774,027 (GRCm39) missense probably benign 0.00
R5015:Ttc21a UTSW 9 119,795,195 (GRCm39) missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119,771,731 (GRCm39) missense probably benign 0.01
R5117:Ttc21a UTSW 9 119,795,631 (GRCm39) missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119,781,278 (GRCm39) missense probably benign 0.04
R5452:Ttc21a UTSW 9 119,780,037 (GRCm39) missense probably benign 0.00
R5733:Ttc21a UTSW 9 119,770,327 (GRCm39) missense probably benign
R5734:Ttc21a UTSW 9 119,795,732 (GRCm39) missense probably benign
R5869:Ttc21a UTSW 9 119,787,858 (GRCm39) missense probably benign 0.03
R6214:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119,773,028 (GRCm39) missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119,770,268 (GRCm39) missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119,771,701 (GRCm39) missense probably benign 0.24
R7060:Ttc21a UTSW 9 119,795,742 (GRCm39) missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119,774,607 (GRCm39) missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119,788,117 (GRCm39) missense probably benign 0.01
R7438:Ttc21a UTSW 9 119,774,605 (GRCm39) missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119,787,135 (GRCm39) missense probably benign 0.12
R7703:Ttc21a UTSW 9 119,788,095 (GRCm39) missense probably benign 0.14
R8076:Ttc21a UTSW 9 119,795,392 (GRCm39) missense probably benign 0.01
R8217:Ttc21a UTSW 9 119,783,694 (GRCm39) missense probably benign 0.00
R8471:Ttc21a UTSW 9 119,792,242 (GRCm39) splice site probably null
R8558:Ttc21a UTSW 9 119,787,835 (GRCm39) missense probably damaging 0.97
R8696:Ttc21a UTSW 9 119,772,977 (GRCm39) missense possibly damaging 0.80
R8739:Ttc21a UTSW 9 119,796,371 (GRCm39) missense probably benign 0.00
R8768:Ttc21a UTSW 9 119,770,286 (GRCm39) missense probably damaging 1.00
R8912:Ttc21a UTSW 9 119,770,367 (GRCm39) critical splice donor site probably null
R9006:Ttc21a UTSW 9 119,792,130 (GRCm39) intron probably benign
R9214:Ttc21a UTSW 9 119,772,941 (GRCm39) missense probably benign 0.17
R9235:Ttc21a UTSW 9 119,774,559 (GRCm39) missense probably benign 0.03
R9521:Ttc21a UTSW 9 119,787,181 (GRCm39) missense probably damaging 0.98
R9643:Ttc21a UTSW 9 119,771,686 (GRCm39) missense probably benign
RF004:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119,771,746 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCATGGAGAAGGGCTG -3'
(R):5'- GAGGGTTCTTTCTATAGGCCTC -3'

Sequencing Primer
(F):5'- CATGGAGAAGGGCTGGAGGG -3'
(R):5'- TCGTCATACACCTCCAGGG -3'
Posted On 2019-05-13