Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Slc25a16'

544913

Institutional Source

Beutler Lab

Gene Symbol

Slc25a16

Ensembl Gene

ENSMUSG00000071253

Gene Name

solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16

Synonyms

HGT.1, ML7, 3110021G18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62920633-62946498 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62937454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 156 (V156E)

Ref Sequence

ENSEMBL: ENSMUSP00000114510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044977] [ENSMUST00000144459]

AlphaFold

Q8C0K5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044977
AA Change: V153E

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043370
Gene: ENSMUSG00000071253
AA Change: V153E

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:Mito_carr	32	125	1.7e-25	PFAM
Pfam:Mito_carr	127	220	2.3e-26	PFAM
Pfam:Mito_carr	237	332	8.6e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144459
AA Change: V156E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114510
Gene: ENSMUSG00000071253
AA Change: V156E

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:Mito_carr	32	125	9.4e-28	PFAM
Pfam:Mito_carr	126	223	4.6e-25	PFAM
Pfam:Mito_carr	240	322	2.3e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains three tandemly repeated mitochondrial carrier protein domains. The encoded protein is localized in the inner membrane and facilitates the rapid transport and exchange of molecules between the cytosol and the mitochondrial matrix space. This gene has a possible role in Graves' disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Slc25a16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Slc25a16	APN	10	62944433	splice site	probably null
IGL01963:Slc25a16	APN	10	62930441	splice site	probably null
IGL02130:Slc25a16	APN	10	62944358	missense	probably benign	0.02
R1503:Slc25a16	UTSW	10	62928376	missense	probably damaging	1.00
R1533:Slc25a16	UTSW	10	62920864	missense	probably damaging	0.97
R2067:Slc25a16	UTSW	10	62932751	missense	probably benign	0.25
R4388:Slc25a16	UTSW	10	62928326	missense	probably benign	0.18
R6225:Slc25a16	UTSW	10	62928323	missense	probably damaging	1.00
R6457:Slc25a16	UTSW	10	62941159	missense	probably benign	0.20
R6459:Slc25a16	UTSW	10	62937477	nonsense	probably null
R7814:Slc25a16	UTSW	10	62937420	missense	probably benign	0.00
R8792:Slc25a16	UTSW	10	62928340	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCTTAGGTACTGCTATTGGATGG -3'
(R):5'- CAAACACCAGCTTCTCAGGG -3'

Sequencing Primer
(F):5'- ACTGCTATTGGATGGTTTGAGTC -3'
(R):5'- AGGCAAGTGTTCTACCACTG -3'

Posted On

2019-05-13