Incidental Mutation 'R7009:Acadvl'
ID 544918
Institutional Source Beutler Lab
Gene Symbol Acadvl
Ensembl Gene ENSMUSG00000018574
Gene Name acyl-Coenzyme A dehydrogenase, very long chain
Synonyms VLCAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70010183-70015411 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 70014791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018718] [ENSMUST00000019362] [ENSMUST00000102574] [ENSMUST00000102575] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000133140] [ENSMUST00000134376] [ENSMUST00000231221] [ENSMUST00000231415] [ENSMUST00000232002] [ENSMUST00000231506] [ENSMUST00000190940]
AlphaFold P50544
Predicted Effect probably benign
Transcript: ENSMUST00000018718
SMART Domains Protein: ENSMUSP00000018718
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 74 188 4.4e-22 PFAM
Pfam:Acyl-CoA_dh_M 192 245 5.1e-20 PFAM
Pfam:Acyl-CoA_dh_1 306 455 6.7e-41 PFAM
Pfam:Acyl-CoA_dh_2 321 445 2.8e-12 PFAM
Blast:HisKA 460 557 6e-10 BLAST
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019362
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083600
Predicted Effect probably null
Transcript: ENSMUST00000102574
SMART Domains Protein: ENSMUSP00000099634
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 96 210 2.5e-25 PFAM
Pfam:Acyl-CoA_dh_M 214 316 5.5e-25 PFAM
Pfam:Acyl-CoA_dh_1 328 477 2.5e-41 PFAM
Pfam:Acyl-CoA_dh_2 343 467 8.7e-14 PFAM
Blast:HisKA 482 579 7e-10 BLAST
low complexity region 580 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102575
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108586
Predicted Effect probably benign
Transcript: ENSMUST00000108588
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108589
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123687
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133140
SMART Domains Protein: ENSMUSP00000126707
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
PDZ 13 92 3.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134376
SMART Domains Protein: ENSMUSP00000115206
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 97 3.39e-37 SMART
PDZ 106 165 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146129
Predicted Effect probably benign
Transcript: ENSMUST00000231221
Predicted Effect probably benign
Transcript: ENSMUST00000231415
Predicted Effect probably benign
Transcript: ENSMUST00000232002
Predicted Effect probably benign
Transcript: ENSMUST00000231506
Predicted Effect probably benign
Transcript: ENSMUST00000190940
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a homodimeric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C16- and C20-acylCoA and localizes to the inner mitochondrial membrane (unlike related acyl-CoA dehydrogenases). In mice, deficiency of this gene can cause ventricular arrhythmias as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant animals exhibit mild steatosis, lipid accumulation in myocytes, increased fatigue, impaired temperature regulation, increased susceptibility to arrhythmia, accumulation of long-chain acylcarnitines, and lower free carnitine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Acadvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03391:Acadvl APN 11 70010716 missense probably damaging 0.99
IGL03396:Acadvl APN 11 70011413 nonsense probably null
R1122:Acadvl UTSW 11 70011377 missense probably damaging 1.00
R1271:Acadvl UTSW 11 70014700 missense probably damaging 1.00
R1435:Acadvl UTSW 11 70014816 missense probably benign 0.00
R1519:Acadvl UTSW 11 70014791 critical splice donor site probably null
R1710:Acadvl UTSW 11 70010355 missense probably damaging 1.00
R1853:Acadvl UTSW 11 70010870 missense probably damaging 1.00
R4747:Acadvl UTSW 11 70012508 missense probably damaging 1.00
R4822:Acadvl UTSW 11 70011184 missense probably benign 0.01
R5700:Acadvl UTSW 11 70013203 missense probably damaging 0.99
R6312:Acadvl UTSW 11 70011767 missense probably damaging 0.99
R6482:Acadvl UTSW 11 70011562 missense probably benign 0.00
R6489:Acadvl UTSW 11 70010319 missense probably benign 0.00
R6904:Acadvl UTSW 11 70014333 missense probably benign 0.31
R7623:Acadvl UTSW 11 70010743 missense probably damaging 1.00
R8103:Acadvl UTSW 11 70014342 missense probably benign 0.00
R8439:Acadvl UTSW 11 70011728 nonsense probably null
R8556:Acadvl UTSW 11 70013550 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTAAGCCTTTACTTACCAGATGGG -3'
(R):5'- TGGCAGTTCTGTCACTGAAAG -3'

Sequencing Primer
(F):5'- ATTCCTAGGCAAGGAAGG -3'
(R):5'- CAGTTCTGTCACTGAAAGTAGGG -3'
Posted On 2019-05-13