Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Ggps1'

544923

Institutional Source

Beutler Lab

Gene Symbol

Ggps1

Ensembl Gene

ENSMUSG00000021302

Gene Name

geranylgeranyl diphosphate synthase 1

Synonyms

GGPP synthase, 9530089B04Rik, 1810026C22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14050659-14063488 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 14054165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 8 (Y8*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170957] [ENSMUST00000221338] [ENSMUST00000221713] [ENSMUST00000221953] [ENSMUST00000222164] [ENSMUST00000222687] [ENSMUST00000222747] [ENSMUST00000223090] [ENSMUST00000223174]

AlphaFold

Q9WTN0

Predicted Effect

probably null
Transcript: ENSMUST00000170957
AA Change: Y144*

SMART Domains

Protein: ENSMUSP00000126603
Gene: ENSMUSG00000021302
AA Change: Y144*

Domain	Start	End	E-Value	Type
Pfam:polyprenyl_synt	14	256	2.8e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221338

Predicted Effect

probably benign
Transcript: ENSMUST00000221713

Predicted Effect

probably benign
Transcript: ENSMUST00000221953

Predicted Effect

probably null
Transcript: ENSMUST00000222164
AA Change: Y144*

Predicted Effect

probably null
Transcript: ENSMUST00000222687
AA Change: Y90*

Predicted Effect

probably null
Transcript: ENSMUST00000222747
AA Change: Y144*

Predicted Effect

probably null
Transcript: ENSMUST00000223090
AA Change: Y97*

Predicted Effect

probably null
Transcript: ENSMUST00000223174
AA Change: Y144*

Predicted Effect

probably null
Transcript: ENSMUST00000223329
AA Change: Y8*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the prenyltransferase family and encodes a protein with geranylgeranyl diphosphate (GGPP) synthase activity. The enzyme catalyzes the synthesis of GGPP from farnesyl diphosphate and isopentenyl diphosphate. GGPP is an important molecule responsible for the C20-prenylation of proteins and for the regulation of a nuclear hormone receptor. Alternate transcriptional splice variants, both protein-coding and non-protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Ggps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Ggps1	APN	13	14054388	missense	probably damaging	1.00
IGL01869:Ggps1	APN	13	14054394	missense	probably damaging	1.00
R0319:Ggps1	UTSW	13	14053877	missense	possibly damaging	0.94
R3893:Ggps1	UTSW	13	14053699	missense	probably benign
R4049:Ggps1	UTSW	13	14053699	missense	probably benign
R4050:Ggps1	UTSW	13	14053699	missense	probably benign
R6003:Ggps1	UTSW	13	14054002	missense	probably benign	0.05
R6021:Ggps1	UTSW	13	14054004	missense	probably damaging	1.00
R6283:Ggps1	UTSW	13	14057794	critical splice donor site	probably null
R7853:Ggps1	UTSW	13	14054449	missense	probably benign	0.00
R8786:Ggps1	UTSW	13	14053920	missense	probably benign	0.01
R8933:Ggps1	UTSW	13	14054343	missense	probably benign	0.11
R9514:Ggps1	UTSW	13	14055157	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- CCTTCTGTCAAGTCTTCACAGAAAC -3'
(R):5'- CAGTTCAAAGCTCCGACGTG -3'

Sequencing Primer
(F):5'- CTGTCAAGTCTTCACAGAAACTTTTG -3'
(R):5'- AAAGCTCCGACGTGGTTTC -3'

Posted On

2019-05-13