Mutagenetix > Incidental Mutations

Incidental Mutation 'R7009:Rnf31'

544931

Institutional Source

Beutler Lab

Gene Symbol

Rnf31

Ensembl Gene

ENSMUSG00000047098

Gene Name

ring finger protein 31

Synonyms

Paul, HOIP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55591708-55603693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55592551 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 143 (Y143H)

Ref Sequence

ENSEMBL: ENSMUSP00000019443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000111378] [ENSMUST00000159687] [ENSMUST00000161807]

Predicted Effect

probably benign
Transcript: ENSMUST00000019443
AA Change: Y143H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: Y143H

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	68	148	7.1e-17	PFAM
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	405	429	4.86e-1	SMART
Pfam:HOIP-UBA	477	622	2.4e-54	PFAM
Blast:RING	693	741	7e-25	BLAST
IBR	773	835	3.18e-14	SMART
IBR	847	924	5.35e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111378

SMART Domains

Protein: ENSMUSP00000107009
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	2.2e-26	PFAM
Pfam:PA28_beta	82	231	1.7e-66	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: Y44H

Domain	Start	End	E-Value	Type
PDB:4OYJ\|M	2	85	1e-29	PDB
low complexity region	164	196	N/A	INTRINSIC
ZnF_RBZ	200	224	2.56e-1	SMART
ZnF_RBZ	248	272	6.93e-5	SMART
ZnF_RBZ	307	331	4.86e-1	SMART
Pfam:HOIP-UBA	369	468	1.1e-31	PFAM
Blast:RING	539	587	9e-25	BLAST
IBR	619	681	3.18e-14	SMART
IBR	693	770	5.35e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159687

SMART Domains

Protein: ENSMUSP00000125596
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	1.2e-26	PFAM
Pfam:PA28_beta	82	165	3e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161807

SMART Domains

Protein: ENSMUSP00000123798
Gene: ENSMUSG00000079197

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	11	71	1.2e-26	PFAM
Pfam:PA28_beta	93	237	5.3e-58	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Npr3	C	T	15: 11,905,248	C131Y	probably damaging	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Rnf31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rnf31	APN	14	55592319	splice site	probably null
IGL01532:Rnf31	APN	14	55602623	missense	probably damaging	0.99
IGL02118:Rnf31	APN	14	55599112	missense	probably damaging	1.00
IGL02272:Rnf31	APN	14	55598782	missense	probably damaging	1.00
IGL02893:Rnf31	APN	14	55599109	missense	probably damaging	1.00
IGL02939:Rnf31	APN	14	55595674	missense	probably benign	0.30
R0285:Rnf31	UTSW	14	55601389	missense	probably damaging	0.96
R0678:Rnf31	UTSW	14	55601713	nonsense	probably null
R0924:Rnf31	UTSW	14	55593002	unclassified	probably benign
R1386:Rnf31	UTSW	14	55596764	missense	probably damaging	1.00
R1507:Rnf31	UTSW	14	55598982	nonsense	probably null
R2122:Rnf31	UTSW	14	55596197	missense	probably damaging	1.00
R2164:Rnf31	UTSW	14	55592537	missense	possibly damaging	0.90
R3714:Rnf31	UTSW	14	55603394	missense	probably damaging	1.00
R3921:Rnf31	UTSW	14	55601142	missense	probably damaging	1.00
R4348:Rnf31	UTSW	14	55601098	frame shift	probably null
R4349:Rnf31	UTSW	14	55601098	frame shift	probably null
R4350:Rnf31	UTSW	14	55601098	frame shift	probably null
R4351:Rnf31	UTSW	14	55601098	frame shift	probably null
R4353:Rnf31	UTSW	14	55601098	frame shift	probably null
R4472:Rnf31	UTSW	14	55603320	missense	probably damaging	1.00
R5004:Rnf31	UTSW	14	55592182	missense	probably damaging	1.00
R5245:Rnf31	UTSW	14	55601706	missense	probably damaging	1.00
R5286:Rnf31	UTSW	14	55592236	missense	probably damaging	1.00
R5669:Rnf31	UTSW	14	55596704	missense	probably damaging	1.00
R5750:Rnf31	UTSW	14	55598686	missense	probably damaging	1.00
R6377:Rnf31	UTSW	14	55595527	missense	probably damaging	1.00
R7018:Rnf31	UTSW	14	55592233	missense	probably damaging	1.00
R7670:Rnf31	UTSW	14	55594361	missense	probably benign	0.08
R7876:Rnf31	UTSW	14	55593077	critical splice donor site	probably null
R8490:Rnf31	UTSW	14	55596109	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGGACTAGACCTGTGCTTAG -3'
(R):5'- GTAACAGAAGCTTCCAGGCTG -3'

Sequencing Primer
(F):5'- CTGTGCTTAGGGTTGACCAGAAAG -3'
(R):5'- TTCCAGGCTGGCTGCTG -3'

Posted On

2019-05-13