Incidental Mutation 'R7009:Clu'
ID 544932
Institutional Source Beutler Lab
Gene Symbol Clu
Ensembl Gene ENSMUSG00000022037
Gene Name clusterin
Synonyms D14Ucla3, Sgp-2, Sgp2, ApoJ, Cli, SP-40, Sugp-2, complement lysis inhibitor, Apolipoprotein J, testosterone repressed prostate message-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65968483-65981547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65971832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 113 (V113D)
Ref Sequence ENSEMBL: ENSMUSP00000117953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022616] [ENSMUST00000127387] [ENSMUST00000128539] [ENSMUST00000138191] [ENSMUST00000138665] [ENSMUST00000144619] [ENSMUST00000153460]
AlphaFold Q06890
Predicted Effect possibly damaging
Transcript: ENSMUST00000022616
AA Change: V25D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022616
Gene: ENSMUSG00000022037
AA Change: V25D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
CLa 227 442 2.3e-156 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127387
AA Change: V25D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114720
Gene: ENSMUSG00000022037
AA Change: V25D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128539
AA Change: V25D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121485
Gene: ENSMUSG00000022037
AA Change: V25D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 203 3.48e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138191
AA Change: V25D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117555
Gene: ENSMUSG00000022037
AA Change: V25D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 225 2.18e-148 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138665
AA Change: V25D
Predicted Effect probably damaging
Transcript: ENSMUST00000144619
AA Change: V113D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117953
Gene: ENSMUSG00000022037
AA Change: V113D

DomainStartEndE-ValueType
low complexity region 92 100 N/A INTRINSIC
CLb 110 209 1.16e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153460
AA Change: V25D

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121633
Gene: ENSMUSG00000022037
AA Change: V25D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Blast:CLa 227 265 2e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: The protein encoded by this gene is a secreted chaperone that can, under some stress conditions, also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric mature protein comprised of alpha and beta subunits. Mice lacking the encoded protein exhibit increased severity of autoimmune myocarditis, faster progression of the acute inflammation to myocardial scarring and decreased brain injury following neonatal hypoxic-ischemic injury. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive renal glomerulopathy and increased severity of myosin-induced autoimmune myocarditis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Clu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clu APN 14 65975588 missense probably damaging 0.98
IGL01657:Clu APN 14 65979672 missense possibly damaging 0.81
IGL02030:Clu APN 14 65975791 missense probably benign 0.08
IGL02891:Clu APN 14 65975984 missense probably damaging 0.96
IGL03163:Clu APN 14 65979786 missense probably benign 0.06
R1378:Clu UTSW 14 65974901 missense probably damaging 1.00
R1417:Clu UTSW 14 65974971 nonsense probably null
R1711:Clu UTSW 14 65980905 missense possibly damaging 0.63
R2134:Clu UTSW 14 65974841 critical splice acceptor site probably null
R2285:Clu UTSW 14 65980959 missense probably benign 0.03
R2340:Clu UTSW 14 65980909 missense probably damaging 0.99
R2508:Clu UTSW 14 65975003 missense probably damaging 1.00
R4700:Clu UTSW 14 65979864 missense probably benign 0.25
R4981:Clu UTSW 14 65973366 missense probably damaging 0.97
R5062:Clu UTSW 14 65979728 missense probably damaging 0.99
R5422:Clu UTSW 14 65975602 missense probably damaging 0.99
R6389:Clu UTSW 14 65971322 intron probably benign
R8306:Clu UTSW 14 65979762 missense probably damaging 1.00
R8681:Clu UTSW 14 65980957 missense probably damaging 1.00
R9082:Clu UTSW 14 65979704 missense probably damaging 1.00
R9614:Clu UTSW 14 65971402 missense unknown
R9686:Clu UTSW 14 65975005 missense probably damaging 1.00
X0025:Clu UTSW 14 65971814 missense probably damaging 1.00
Z1088:Clu UTSW 14 65976913 missense probably benign 0.00
Z1177:Clu UTSW 14 65975921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTGATGCCAGATGAGG -3'
(R):5'- ATGTCTAGAAGTCACCTGACCAC -3'

Sequencing Primer
(F):5'- CCTCTCAGGGAGCTGTAGCAG -3'
(R):5'- CAAAAACATCAAGACAGGACCTAGAG -3'
Posted On 2019-05-13