Mutagenetix > Incidental Mutation

Incidental Mutation 'R7009:Npr3'

544934

Institutional Source

Beutler Lab

Gene Symbol

Npr3

Ensembl Gene

ENSMUSG00000022206

Gene Name

natriuretic peptide receptor 3

Synonyms

longjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.545) question?

Stock #

R7009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11839896-11907287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11905248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 131 (C131Y)

Ref Sequence

ENSEMBL: ENSMUSP00000154180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]

AlphaFold

P70180

Predicted Effect

probably damaging
Transcript: ENSMUST00000066529
AA Change: C131Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: C131Y

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:ANF_receptor	66	417	1e-59	PFAM
transmembrane domain	477	499	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228489

Predicted Effect

probably damaging
Transcript: ENSMUST00000228603
AA Change: C131Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,784,520	D193V	probably damaging	Het
4921517D22Rik	G	T	13: 59,690,810	D69E	possibly damaging	Het
Abat	A	C	16: 8,602,367	M177L	probably benign	Het
Acadvl	A	G	11: 70,014,791		probably null	Het
Adam5	T	C	8: 24,806,438	N331S	probably benign	Het
Ager	A	G	17: 34,600,736	E372G	probably damaging	Het
Angpt1	T	A	15: 42,523,595	Q121L	possibly damaging	Het
Apoa4	A	T	9: 46,242,880	I260F	possibly damaging	Het
Arhgap32	A	T	9: 32,245,976	I90F	probably damaging	Het
Arhgap5	A	T	12: 52,519,639	Q1131L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Cacna2d3	A	T	14: 28,969,365	M1K	probably null	Het
Ccdc18	G	A	5: 108,173,862		probably null	Het
Ccdc42	T	C	11: 68,594,616	F267S	probably damaging	Het
Cdh23	T	A	10: 60,337,306	Y1700F	probably damaging	Het
Cenpe	A	T	3: 135,235,201	S704C	probably damaging	Het
Cenpe	G	A	3: 135,235,202	S704N	probably benign	Het
Cfap54	A	T	10: 92,875,019	S2727T	unknown	Het
Clu	T	A	14: 65,971,832	V113D	probably damaging	Het
Cnbd2	A	G	2: 156,320,034	I98V	probably benign	Het
Copa	G	T	1: 172,091,000	R97L	probably damaging	Het
Epb41l1	C	A	2: 156,534,683		probably null	Het
Etnk1	T	A	6: 143,203,154		probably null	Het
Fnip1	A	T	11: 54,502,935	K732N	probably damaging	Het
G6pd2	A	G	5: 61,808,891	E3G	probably benign	Het
Gal3st2	A	G	1: 93,873,759	T95A	probably benign	Het
Gapvd1	A	G	2: 34,700,817	S948P	probably damaging	Het
Ggps1	A	T	13: 14,054,165	Y8*	probably null	Het
Gria2	T	C	3: 80,706,972	E587G	probably damaging	Het
Hpse	T	C	5: 100,692,279	E324G	probably benign	Het
Il16	G	A	7: 83,646,388	T493I	probably benign	Het
Ints1	T	C	5: 139,768,462	T652A	possibly damaging	Het
Ism1	A	G	2: 139,757,279	I391V	probably damaging	Het
Katnb1	A	G	8: 95,098,384	D598G	probably damaging	Het
Kif5c	A	G	2: 49,757,429	S880G	probably benign	Het
Klra8	T	C	6: 130,125,184	N96S	probably benign	Het
Krt79	T	A	15: 101,931,441	D373V	probably damaging	Het
Lamtor4	G	A	5: 138,259,112	R92Q	probably benign	Het
Lce1d	C	A	3: 92,686,046	C20F	unknown	Het
Limk1	T	C	5: 134,672,699	T117A	probably benign	Het
Medag	A	T	5: 149,427,243	K61M	probably benign	Het
Mkrn3	T	C	7: 62,419,618	M142V	probably benign	Het
Mob3c	G	A	4: 115,831,582	R104H	probably benign	Het
Morc1	G	T	16: 48,627,070	R903L	possibly damaging	Het
Myh6	T	C	14: 54,952,292	E1099G	probably damaging	Het
Nphp3	T	G	9: 104,016,116	C434G	probably null	Het
Oacyl	C	A	18: 65,722,538	Y112*	probably null	Het
Oprl1	A	G	2: 181,718,381	T77A	probably damaging	Het
Osgep	A	G	14: 50,924,708	V24A	probably damaging	Het
Otx2	T	A	14: 48,658,797	K260M	probably damaging	Het
Pdcd11	T	C	19: 47,113,142	L922P	probably benign	Het
Phldb1	A	G	9: 44,694,408	V375A	probably damaging	Het
Pip5k1b	C	T	19: 24,359,935		probably null	Het
Psmd3	G	A	11: 98,682,766	D13N	probably benign	Het
Ptprc	G	A	1: 138,064,553	H1140Y	probably damaging	Het
Ranbp3l	A	T	15: 9,062,984	H291L	probably damaging	Het
Rasa4	T	A	5: 136,101,363	D324E	probably damaging	Het
Rilpl1	T	A	5: 124,503,692		silent	Het
Rin2	A	C	2: 145,883,475	D794A	probably damaging	Het
Ripk1	A	G	13: 34,030,062	I522M	probably damaging	Het
Rnf31	T	C	14: 55,592,551	Y143H	probably benign	Het
Rp1	T	G	1: 4,042,068	I1187L	unknown	Het
Rps6ka5	G	A	12: 100,619,537	H166Y	probably damaging	Het
Rrm1	T	C	7: 102,460,334	V455A	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Scn5a	T	G	9: 119,485,930	E1904A	probably damaging	Het
Sec16a	G	T	2: 26,436,002	S240*	probably null	Het
Slc22a8	C	T	19: 8,605,417	T154I	probably benign	Het
Slc25a16	T	A	10: 62,937,454	V156E	possibly damaging	Het
Slc28a3	A	T	13: 58,610,804	S2T	probably benign	Het
Srd5a3	G	A	5: 76,149,866	V48I	probably benign	Het
Srebf1	A	C	11: 60,200,526	H1025Q	probably damaging	Het
Stard9	A	G	2: 120,697,191	K1310E	probably benign	Het
Swt1	A	G	1: 151,370,630	V848A	possibly damaging	Het
Tanc2	A	T	11: 105,840,699	T434S	possibly damaging	Het
Tcf20	G	A	15: 82,854,682	T856I	probably benign	Het
Tcf7l2	T	C	19: 55,894,733		probably null	Het
Tmem246	A	T	4: 49,586,325	M281K	probably benign	Het
Trim45	A	G	3: 100,931,879		probably benign	Het
Tsen2	T	A	6: 115,547,972	M44K	possibly damaging	Het
Ttc21a	T	A	9: 119,958,073	C715*	probably null	Het
Vmn2r102	G	A	17: 19,694,194	V674I	probably damaging	Het
Zfp87	A	G	13: 67,517,054	S430P	probably damaging	Het

Other mutations in Npr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Npr3	APN	15	11895694	missense	probably damaging	1.00
IGL01420:Npr3	APN	15	11858632	missense	probably damaging	1.00
IGL01599:Npr3	APN	15	11895789	missense	probably damaging	1.00
IGL01977:Npr3	APN	15	11858718	missense	probably damaging	1.00
eel	UTSW	15	11858647	missense	probably damaging	0.99
Electric	UTSW	15	11848603	missense	possibly damaging	0.73
Morray	UTSW	15	11851450	missense	probably damaging	0.99
R0581:Npr3	UTSW	15	11851450	missense	probably damaging	0.99
R0607:Npr3	UTSW	15	11845282	missense	probably benign	0.32
R1554:Npr3	UTSW	15	11848563	missense	probably benign
R1779:Npr3	UTSW	15	11851486	missense	probably damaging	1.00
R1793:Npr3	UTSW	15	11848579	missense	probably benign	0.05
R1968:Npr3	UTSW	15	11904969	missense	probably benign	0.31
R2379:Npr3	UTSW	15	11883363	missense	probably damaging	0.99
R2883:Npr3	UTSW	15	11883324	missense	possibly damaging	0.50
R3080:Npr3	UTSW	15	11905149	missense	probably benign	0.01
R3745:Npr3	UTSW	15	11905491	missense	probably damaging	1.00
R3803:Npr3	UTSW	15	11895790	missense	probably damaging	1.00
R4166:Npr3	UTSW	15	11848513	missense	probably benign	0.32
R4411:Npr3	UTSW	15	11905149	missense	probably benign	0.01
R4412:Npr3	UTSW	15	11905149	missense	probably benign	0.01
R4667:Npr3	UTSW	15	11905467	missense	possibly damaging	0.58
R5209:Npr3	UTSW	15	11848603	missense	possibly damaging	0.73
R5742:Npr3	UTSW	15	11883408	missense	probably damaging	1.00
R6339:Npr3	UTSW	15	11845275	missense	probably damaging	0.99
R6605:Npr3	UTSW	15	11905432	missense	probably damaging	1.00
R6890:Npr3	UTSW	15	11883392	missense	possibly damaging	0.89
R7371:Npr3	UTSW	15	11845290	critical splice acceptor site	probably null
R7582:Npr3	UTSW	15	11895682	missense	probably null	1.00
R7743:Npr3	UTSW	15	11905638	start codon destroyed	probably null	0.90
R7896:Npr3	UTSW	15	11883362	missense	probably damaging	1.00
R8672:Npr3	UTSW	15	11851493	missense	probably damaging	1.00
R8840:Npr3	UTSW	15	11905243	missense	probably damaging	0.98
S24628:Npr3	UTSW	15	11848563	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGAGCGAGCATCATCTCTC -3'
(R):5'- TTGTTCTATTGCCCCGGGAC -3'

Sequencing Primer
(F):5'- GAGCGAGCATCATCTCTCCCATC -3'
(R):5'- GGACGATTCGTACTTGTTCTCGC -3'

Posted On

2019-05-13