Incidental Mutation 'R7009:Morc1'
ID 544939
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Name microrchidia 1
Synonyms
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 48251600-48451263 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 48447433 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 903 (R903L)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
AlphaFold Q9WVL5
Predicted Effect possibly damaging
Transcript: ENSMUST00000023330
AA Change: R903L

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: R903L

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Kif5c A G 2: 49,647,441 (GRCm39) S880G probably benign Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rp1 T G 1: 4,112,291 (GRCm39) I1187L unknown Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Ttc21a T A 9: 119,787,139 (GRCm39) C715* probably null Het
Vmn2r102 G A 17: 19,914,456 (GRCm39) V674I probably damaging Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48,432,689 (GRCm39) missense probably damaging 0.98
IGL00815:Morc1 APN 16 48,281,055 (GRCm39) missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48,272,952 (GRCm39) missense probably damaging 0.99
IGL01321:Morc1 APN 16 48,402,825 (GRCm39) missense probably benign 0.00
IGL01410:Morc1 APN 16 48,432,677 (GRCm39) missense probably benign 0.16
IGL01557:Morc1 APN 16 48,319,129 (GRCm39) missense probably damaging 1.00
IGL02118:Morc1 APN 16 48,407,467 (GRCm39) missense probably benign 0.01
IGL02626:Morc1 APN 16 48,436,123 (GRCm39) missense probably damaging 0.96
IGL02692:Morc1 APN 16 48,330,596 (GRCm39) missense probably null 0.95
IGL02812:Morc1 APN 16 48,378,869 (GRCm39) splice site probably benign
IGL03232:Morc1 APN 16 48,451,165 (GRCm39) missense probably benign 0.06
IGL03331:Morc1 APN 16 48,432,731 (GRCm39) splice site probably benign
IGL03408:Morc1 APN 16 48,262,775 (GRCm39) missense probably damaging 1.00
R0545:Morc1 UTSW 16 48,386,020 (GRCm39) missense probably benign 0.05
R0569:Morc1 UTSW 16 48,407,485 (GRCm39) missense probably benign 0.02
R0699:Morc1 UTSW 16 48,412,977 (GRCm39) missense probably benign 0.01
R1717:Morc1 UTSW 16 48,272,840 (GRCm39) missense probably benign 0.01
R1728:Morc1 UTSW 16 48,432,660 (GRCm39) missense probably benign 0.10
R1803:Morc1 UTSW 16 48,443,001 (GRCm39) missense probably benign 0.14
R1864:Morc1 UTSW 16 48,412,893 (GRCm39) missense probably benign 0.01
R2008:Morc1 UTSW 16 48,386,009 (GRCm39) missense probably benign 0.41
R2070:Morc1 UTSW 16 48,412,974 (GRCm39) missense probably benign 0.00
R2071:Morc1 UTSW 16 48,412,974 (GRCm39) missense probably benign 0.00
R4851:Morc1 UTSW 16 48,381,980 (GRCm39) missense probably benign 0.02
R5013:Morc1 UTSW 16 48,322,699 (GRCm39) missense probably benign 0.11
R5081:Morc1 UTSW 16 48,322,715 (GRCm39) missense probably benign 0.01
R5259:Morc1 UTSW 16 48,451,132 (GRCm39) missense probably benign 0.12
R5342:Morc1 UTSW 16 48,438,872 (GRCm39) missense probably damaging 0.99
R5481:Morc1 UTSW 16 48,381,848 (GRCm39) splice site probably null
R5561:Morc1 UTSW 16 48,269,711 (GRCm39) missense probably benign 0.43
R6356:Morc1 UTSW 16 48,257,652 (GRCm39) missense probably damaging 1.00
R6526:Morc1 UTSW 16 48,407,487 (GRCm39) nonsense probably null
R6743:Morc1 UTSW 16 48,322,683 (GRCm39) missense probably damaging 0.98
R6940:Morc1 UTSW 16 48,300,208 (GRCm39) nonsense probably null
R6994:Morc1 UTSW 16 48,438,909 (GRCm39) missense probably benign 0.39
R6994:Morc1 UTSW 16 48,385,984 (GRCm39) missense probably benign 0.00
R7346:Morc1 UTSW 16 48,451,263 (GRCm39) splice site probably null
R7357:Morc1 UTSW 16 48,442,953 (GRCm39) missense probably benign 0.14
R7448:Morc1 UTSW 16 48,251,708 (GRCm39) missense probably damaging 0.97
R7840:Morc1 UTSW 16 48,319,147 (GRCm39) missense probably benign 0.03
R8417:Morc1 UTSW 16 48,281,103 (GRCm39) missense probably damaging 0.99
X0013:Morc1 UTSW 16 48,407,431 (GRCm39) missense probably benign 0.04
X0027:Morc1 UTSW 16 48,319,174 (GRCm39) missense probably damaging 1.00
Z1176:Morc1 UTSW 16 48,407,421 (GRCm39) missense probably benign 0.03
Z1177:Morc1 UTSW 16 48,386,069 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTCGATTCTTAGCCGCTG -3'
(R):5'- ATCATTCCTGGCATCAAGGC -3'

Sequencing Primer
(F):5'- GGTCCTGAGTTCAAATCCCAG -3'
(R):5'- GCATCAAGGCCTGGGTTAG -3'
Posted On 2019-05-13