Incidental Mutation 'R7009:Vmn2r102'
ID 544941
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Name vomeronasal 2, receptor 102
Synonyms EG224572
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19660399-19694748 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19694194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 674 (V674I)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
AlphaFold L7N279
Predicted Effect probably damaging
Transcript: ENSMUST00000171741
AA Change: V674I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: V674I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna2d3 A T 14: 28,969,365 M1K probably null Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19694368 missense probably damaging 1.00
R0583:Vmn2r102 UTSW 17 19676781 missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19694192 missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19678831 missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19694131 missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
R8126:Vmn2r102 UTSW 17 19660450 missense probably benign 0.02
R8385:Vmn2r102 UTSW 17 19693826 missense possibly damaging 0.89
R8410:Vmn2r102 UTSW 17 19677934 missense possibly damaging 0.85
R9045:Vmn2r102 UTSW 17 19660579 missense probably benign 0.00
R9267:Vmn2r102 UTSW 17 19676666 missense probably damaging 1.00
R9325:Vmn2r102 UTSW 17 19677296 missense probably damaging 1.00
R9363:Vmn2r102 UTSW 17 19677352 missense probably benign 0.04
R9524:Vmn2r102 UTSW 17 19677302 missense possibly damaging 0.74
R9747:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
Z1176:Vmn2r102 UTSW 17 19694043 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACACTCCGATTGTAAAGGC -3'
(R):5'- CAACAGCTGAGCCCTTATTGC -3'

Sequencing Primer
(F):5'- CACTCCGATTGTAAAGGCGAATAATC -3'
(R):5'- GCTGAGCCCTTATTGCACAAAATG -3'
Posted On 2019-05-13