Incidental Mutation 'R7009:Vmn2r102'
ID 544941
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Name vomeronasal 2, receptor 102
Synonyms EG224572
MMRRC Submission 045111-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7009 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19880661-19915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19914456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 674 (V674I)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
AlphaFold L7N279
Predicted Effect probably damaging
Transcript: ENSMUST00000171741
AA Change: V674I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: V674I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G T 13: 59,838,624 (GRCm39) D69E possibly damaging Het
Abat A C 16: 8,420,231 (GRCm39) M177L probably benign Het
Acadvl A G 11: 69,905,617 (GRCm39) probably null Het
Adam5 T C 8: 25,296,454 (GRCm39) N331S probably benign Het
Ager A G 17: 34,819,710 (GRCm39) E372G probably damaging Het
Angpt1 T A 15: 42,386,991 (GRCm39) Q121L possibly damaging Het
Apoa4 A T 9: 46,154,178 (GRCm39) I260F possibly damaging Het
Arhgap32 A T 9: 32,157,272 (GRCm39) I90F probably damaging Het
Arhgap5 A T 12: 52,566,422 (GRCm39) Q1131L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Cacna2d3 A T 14: 28,691,322 (GRCm39) M1K probably null Het
Ccdc18 G A 5: 108,321,728 (GRCm39) probably null Het
Ccdc42 T C 11: 68,485,442 (GRCm39) F267S probably damaging Het
Cdh23 T A 10: 60,173,085 (GRCm39) Y1700F probably damaging Het
Cenpe A T 3: 134,940,962 (GRCm39) S704C probably damaging Het
Cenpe G A 3: 134,940,963 (GRCm39) S704N probably benign Het
Cfap299 A T 5: 98,932,379 (GRCm39) D193V probably damaging Het
Cfap54 A T 10: 92,710,881 (GRCm39) S2727T unknown Het
Clu T A 14: 66,209,281 (GRCm39) V113D probably damaging Het
Cnbd2 A G 2: 156,161,954 (GRCm39) I98V probably benign Het
Copa G T 1: 171,918,567 (GRCm39) R97L probably damaging Het
Epb41l1 C A 2: 156,376,603 (GRCm39) probably null Het
Etnk1 T A 6: 143,148,880 (GRCm39) probably null Het
Fnip1 A T 11: 54,393,761 (GRCm39) K732N probably damaging Het
G6pd2 A G 5: 61,966,234 (GRCm39) E3G probably benign Het
Gal3st2 A G 1: 93,801,481 (GRCm39) T95A probably benign Het
Gapvd1 A G 2: 34,590,829 (GRCm39) S948P probably damaging Het
Ggps1 A T 13: 14,228,750 (GRCm39) Y8* probably null Het
Gria2 T C 3: 80,614,279 (GRCm39) E587G probably damaging Het
Hpse T C 5: 100,840,145 (GRCm39) E324G probably benign Het
Il16 G A 7: 83,295,596 (GRCm39) T493I probably benign Het
Ints1 T C 5: 139,754,217 (GRCm39) T652A possibly damaging Het
Ism1 A G 2: 139,599,199 (GRCm39) I391V probably damaging Het
Katnb1 A G 8: 95,825,012 (GRCm39) D598G probably damaging Het
Kif5c A G 2: 49,647,441 (GRCm39) S880G probably benign Het
Klra8 T C 6: 130,102,147 (GRCm39) N96S probably benign Het
Krt79 T A 15: 101,839,876 (GRCm39) D373V probably damaging Het
Lamtor4 G A 5: 138,257,374 (GRCm39) R92Q probably benign Het
Lce1d C A 3: 92,593,353 (GRCm39) C20F unknown Het
Limk1 T C 5: 134,701,553 (GRCm39) T117A probably benign Het
Medag A T 5: 149,350,708 (GRCm39) K61M probably benign Het
Mkrn3 T C 7: 62,069,366 (GRCm39) M142V probably benign Het
Mob3c G A 4: 115,688,779 (GRCm39) R104H probably benign Het
Morc1 G T 16: 48,447,433 (GRCm39) R903L possibly damaging Het
Myh6 T C 14: 55,189,749 (GRCm39) E1099G probably damaging Het
Nphp3 T G 9: 103,893,315 (GRCm39) C434G probably null Het
Npr3 C T 15: 11,905,334 (GRCm39) C131Y probably damaging Het
Oacyl C A 18: 65,855,609 (GRCm39) Y112* probably null Het
Oprl1 A G 2: 181,360,174 (GRCm39) T77A probably damaging Het
Osgep A G 14: 51,162,165 (GRCm39) V24A probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
Pdcd11 T C 19: 47,101,581 (GRCm39) L922P probably benign Het
Pgap4 A T 4: 49,586,325 (GRCm39) M281K probably benign Het
Phldb1 A G 9: 44,605,705 (GRCm39) V375A probably damaging Het
Pip5k1b C T 19: 24,337,299 (GRCm39) probably null Het
Psmd3 G A 11: 98,573,592 (GRCm39) D13N probably benign Het
Ptprc G A 1: 137,992,291 (GRCm39) H1140Y probably damaging Het
Ranbp3l A T 15: 9,063,064 (GRCm39) H291L probably damaging Het
Rasa4 T A 5: 136,130,217 (GRCm39) D324E probably damaging Het
Rilpl1 T A 5: 124,641,755 (GRCm39) silent Het
Rin2 A C 2: 145,725,395 (GRCm39) D794A probably damaging Het
Ripk1 A G 13: 34,214,045 (GRCm39) I522M probably damaging Het
Rnf31 T C 14: 55,830,008 (GRCm39) Y143H probably benign Het
Rp1 T G 1: 4,112,291 (GRCm39) I1187L unknown Het
Rps6ka5 G A 12: 100,585,796 (GRCm39) H166Y probably damaging Het
Rrm1 T C 7: 102,109,541 (GRCm39) V455A probably damaging Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Scn5a T G 9: 119,314,996 (GRCm39) E1904A probably damaging Het
Sec16a G T 2: 26,326,014 (GRCm39) S240* probably null Het
Slc22a8 C T 19: 8,582,781 (GRCm39) T154I probably benign Het
Slc25a16 T A 10: 62,773,233 (GRCm39) V156E possibly damaging Het
Slc28a3 A T 13: 58,758,618 (GRCm39) S2T probably benign Het
Srd5a3 G A 5: 76,297,713 (GRCm39) V48I probably benign Het
Srebf1 A C 11: 60,091,352 (GRCm39) H1025Q probably damaging Het
Stard9 A G 2: 120,527,672 (GRCm39) K1310E probably benign Het
Swt1 A G 1: 151,246,381 (GRCm39) V848A possibly damaging Het
Tanc2 A T 11: 105,731,525 (GRCm39) T434S possibly damaging Het
Tcf20 G A 15: 82,738,883 (GRCm39) T856I probably benign Het
Tcf7l2 T C 19: 55,883,165 (GRCm39) probably null Het
Trim45 A G 3: 100,839,195 (GRCm39) probably benign Het
Tsen2 T A 6: 115,524,933 (GRCm39) M44K possibly damaging Het
Ttc21a T A 9: 119,787,139 (GRCm39) C715* probably null Het
Zfp87 A G 13: 67,665,173 (GRCm39) S430P probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19,899,154 (GRCm39) missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19,897,771 (GRCm39) missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19,899,185 (GRCm39) splice site probably null
IGL01589:Vmn2r102 APN 17 19,899,066 (GRCm39) missense probably benign
IGL01738:Vmn2r102 APN 17 19,898,020 (GRCm39) missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19,880,731 (GRCm39) missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19,914,191 (GRCm39) missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19,901,447 (GRCm39) missense probably benign
IGL02589:Vmn2r102 APN 17 19,901,480 (GRCm39) missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19,898,170 (GRCm39) missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19,914,328 (GRCm39) missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19,914,286 (GRCm39) missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19,896,958 (GRCm39) missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19,880,851 (GRCm39) missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19,899,025 (GRCm39) missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19,899,025 (GRCm39) missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19,899,025 (GRCm39) missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19,898,112 (GRCm39) missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19,914,630 (GRCm39) missense probably damaging 1.00
R0583:Vmn2r102 UTSW 17 19,897,043 (GRCm39) missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19,898,277 (GRCm39) missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19,899,106 (GRCm39) missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19,898,129 (GRCm39) missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19,897,881 (GRCm39) missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19,914,454 (GRCm39) missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19,880,887 (GRCm39) splice site probably benign
R1473:Vmn2r102 UTSW 17 19,914,843 (GRCm39) missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19,899,032 (GRCm39) missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19,897,770 (GRCm39) missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19,914,755 (GRCm39) missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19,897,881 (GRCm39) missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19,897,006 (GRCm39) missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19,896,949 (GRCm39) missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19,897,003 (GRCm39) missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19,914,930 (GRCm39) missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19,899,093 (GRCm39) missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19,914,787 (GRCm39) missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19,898,088 (GRCm39) missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19,880,845 (GRCm39) missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19,901,475 (GRCm39) missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19,901,475 (GRCm39) missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19,914,975 (GRCm39) missense probably benign
R4535:Vmn2r102 UTSW 17 19,914,975 (GRCm39) missense probably benign
R4662:Vmn2r102 UTSW 17 19,901,424 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19,914,576 (GRCm39) missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19,897,795 (GRCm39) missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19,898,203 (GRCm39) missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19,880,661 (GRCm39) start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19,897,834 (GRCm39) missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19,897,003 (GRCm39) missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19,914,393 (GRCm39) missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19,914,415 (GRCm39) missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19,897,804 (GRCm39) missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19,914,943 (GRCm39) missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19,914,402 (GRCm39) missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19,899,007 (GRCm39) missense probably benign
R6432:Vmn2r102 UTSW 17 19,901,483 (GRCm39) missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19,898,169 (GRCm39) missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19,914,450 (GRCm39) missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19,880,694 (GRCm39) nonsense probably null
R7098:Vmn2r102 UTSW 17 19,914,670 (GRCm39) missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19,897,749 (GRCm39) missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19,896,886 (GRCm39) missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19,901,405 (GRCm39) missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19,914,363 (GRCm39) missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19,898,093 (GRCm39) missense probably benign
R8126:Vmn2r102 UTSW 17 19,880,712 (GRCm39) missense probably benign 0.02
R8385:Vmn2r102 UTSW 17 19,914,088 (GRCm39) missense possibly damaging 0.89
R8410:Vmn2r102 UTSW 17 19,898,196 (GRCm39) missense possibly damaging 0.85
R9045:Vmn2r102 UTSW 17 19,880,841 (GRCm39) missense probably benign 0.00
R9267:Vmn2r102 UTSW 17 19,896,928 (GRCm39) missense probably damaging 1.00
R9325:Vmn2r102 UTSW 17 19,897,558 (GRCm39) missense probably damaging 1.00
R9363:Vmn2r102 UTSW 17 19,897,614 (GRCm39) missense probably benign 0.04
R9524:Vmn2r102 UTSW 17 19,897,564 (GRCm39) missense possibly damaging 0.74
R9747:Vmn2r102 UTSW 17 19,898,129 (GRCm39) missense probably benign 0.00
Z1176:Vmn2r102 UTSW 17 19,914,305 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACACTCCGATTGTAAAGGC -3'
(R):5'- CAACAGCTGAGCCCTTATTGC -3'

Sequencing Primer
(F):5'- CACTCCGATTGTAAAGGCGAATAATC -3'
(R):5'- GCTGAGCCCTTATTGCACAAAATG -3'
Posted On 2019-05-13