Incidental Mutation 'R7010:Pank2'
ID544951
Institutional Source Beutler Lab
Gene Symbol Pank2
Ensembl Gene ENSMUSG00000037514
Gene Namepantothenate kinase 2
Synonyms4933409I19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location131262495-131299188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131280373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 273 (Y273H)
Ref Sequence ENSEMBL: ENSMUSP00000119606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150843] [ENSMUST00000184105] [ENSMUST00000184932]
Predicted Effect probably benign
Transcript: ENSMUST00000145904
SMART Domains Protein: ENSMUSP00000115034
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
Pfam:Fumble 11 128 5.1e-21 PFAM
Pfam:Fumble 121 178 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150843
AA Change: Y273H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514
AA Change: Y273H

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183349
Predicted Effect probably benign
Transcript: ENSMUST00000183388
Predicted Effect probably benign
Transcript: ENSMUST00000184105
SMART Domains Protein: ENSMUSP00000138992
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 154 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184932
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrested spermatogenesis, azoospermia, reduced female fertility, and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Pank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pank2 APN 2 131274169 missense possibly damaging 0.69
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0492:Pank2 UTSW 2 131280260 missense probably damaging 1.00
R0513:Pank2 UTSW 2 131282606 missense probably damaging 1.00
R1415:Pank2 UTSW 2 131282718 nonsense probably null
R1622:Pank2 UTSW 2 131273969 missense probably damaging 1.00
R2217:Pank2 UTSW 2 131282681 splice site probably null
R4690:Pank2 UTSW 2 131274025 missense probably damaging 1.00
R4691:Pank2 UTSW 2 131296281 missense possibly damaging 0.85
R5387:Pank2 UTSW 2 131274262 missense probably benign 0.24
R6175:Pank2 UTSW 2 131280261 nonsense probably null
R6806:Pank2 UTSW 2 131262707 unclassified probably benign
R6848:Pank2 UTSW 2 131282626 missense probably damaging 0.98
R7467:Pank2 UTSW 2 131274047 missense possibly damaging 0.53
R7723:Pank2 UTSW 2 131280338 missense probably damaging 1.00
R8504:Pank2 UTSW 2 131293400 missense probably benign 0.00
R8905:Pank2 UTSW 2 131282726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTTCGAAAACTGGATGAACTAG -3'
(R):5'- TGGAATGAGTCTGTTAAGGCAACAC -3'

Sequencing Primer
(F):5'- TCGAAAACTGGATGAACTAGATTGC -3'
(R):5'- GAGTCTGTTAAGGCAACACTTAATG -3'
Posted On2019-05-13