Incidental Mutation 'R7010:Hook1'
ID544956
Institutional Source Beutler Lab
Gene Symbol Hook1
Ensembl Gene ENSMUSG00000028572
Gene Namehook microtubule tethering protein 1
Synonymsazh, A930033L17Rik, abnormal spermatozoon head shape
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location95967240-96025413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96014811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 512 (L512F)
Ref Sequence ENSEMBL: ENSMUSP00000030306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030306]
PDB Structure
The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000030306
AA Change: L512F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: L512F

DomainStartEndE-ValueType
Pfam:HOOK 14 720 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Hook1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Hook1 APN 4 96022197 missense probably benign 0.25
IGL02229:Hook1 APN 4 96001251 missense possibly damaging 0.93
IGL03338:Hook1 APN 4 95998692 splice site probably benign
PIT4453001:Hook1 UTSW 4 96014852 missense probably damaging 0.99
R0558:Hook1 UTSW 4 95993212 splice site probably benign
R0593:Hook1 UTSW 4 95998786 missense possibly damaging 0.93
R0699:Hook1 UTSW 4 95995840 splice site probably benign
R1004:Hook1 UTSW 4 96022287 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R2140:Hook1 UTSW 4 96013312 frame shift probably null
R2278:Hook1 UTSW 4 95998720 missense probably benign 0.00
R3784:Hook1 UTSW 4 95989651 missense probably damaging 1.00
R4500:Hook1 UTSW 4 95993200 critical splice donor site probably null
R4798:Hook1 UTSW 4 96002557 missense possibly damaging 0.84
R5200:Hook1 UTSW 4 95993130 missense probably damaging 1.00
R5546:Hook1 UTSW 4 96002528 missense probably benign 0.03
R6532:Hook1 UTSW 4 96019756 intron probably null
R6629:Hook1 UTSW 4 96001270 missense probably benign 0.03
R7534:Hook1 UTSW 4 96017597 missense probably benign 0.27
X0027:Hook1 UTSW 4 95995811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATAAACCCATGACTACATTCTGC -3'
(R):5'- AGGCACCCTCAATGAGAAGG -3'

Sequencing Primer
(F):5'- ACCCATGACTACATTCTGCATATG -3'
(R):5'- CCCTCAATGAGAAGGGTAGCATTTC -3'
Posted On2019-05-13