Incidental Mutation 'R7010:Kcnd2'
ID 544957
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21216707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 137 (Y137C)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: Y137C

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AL592187.3 A T 15: 77,486,797 (GRCm39) Y58F probably benign Het
Ano10 T C 9: 122,082,190 (GRCm39) T494A probably damaging Het
Asah2 A T 19: 32,031,954 (GRCm39) F72I probably benign Het
Atat1 T C 17: 36,219,522 (GRCm39) D114G probably damaging Het
Atp6v1e2 C T 17: 87,251,773 (GRCm39) M208I probably benign Het
Bicd1 A G 6: 149,396,113 (GRCm39) Y161C probably damaging Het
Camk2g T C 14: 20,791,512 (GRCm39) S410G probably benign Het
Car2 C T 3: 14,965,113 (GRCm39) P249L possibly damaging Het
Cdh23 T G 10: 60,366,770 (GRCm39) I237L probably benign Het
Dlat T A 9: 50,569,274 (GRCm39) K176N probably damaging Het
Dnajc12 T A 10: 63,233,059 (GRCm39) C67S probably benign Het
Fat1 G T 8: 45,406,386 (GRCm39) E1046* probably null Het
Gmip G A 8: 70,264,050 (GRCm39) A137T probably damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Grk6 A G 13: 55,598,113 (GRCm39) I62V possibly damaging Het
Hook1 G T 4: 95,903,048 (GRCm39) L512F probably damaging Het
Ighe T C 12: 113,236,761 (GRCm39) T36A Het
Il17rc A G 6: 113,456,249 (GRCm39) N338S possibly damaging Het
Itgb6 T C 2: 60,480,322 (GRCm39) Y338C probably damaging Het
L3mbtl3 T A 10: 26,158,759 (GRCm39) probably null Het
Lcn3 T C 2: 25,656,068 (GRCm39) F41S probably damaging Het
Map3k8 T C 18: 4,334,060 (GRCm39) H344R probably damaging Het
Marf1 A T 16: 13,954,865 (GRCm39) I884N probably damaging Het
Nalcn G A 14: 123,530,877 (GRCm39) T1387I probably damaging Het
Nrros T C 16: 31,962,398 (GRCm39) T540A probably damaging Het
Or5p63 A T 7: 107,811,349 (GRCm39) I129N probably damaging Het
Pank2 T C 2: 131,122,293 (GRCm39) Y273H probably benign Het
Pgrmc2 A G 3: 41,037,068 (GRCm39) V121A probably damaging Het
Phldb2 C T 16: 45,571,868 (GRCm39) V1175M probably damaging Het
Prss3b A C 6: 41,009,247 (GRCm39) S196A probably benign Het
Ranbp2 A G 10: 58,290,393 (GRCm39) probably null Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Syt7 A G 19: 10,395,354 (GRCm39) T55A probably benign Het
Tfcp2l1 T C 1: 118,581,457 (GRCm39) S137P probably damaging Het
Tom1 T A 8: 75,778,603 (GRCm39) V140D probably damaging Het
Ttc23l T G 15: 10,515,224 (GRCm39) I385L probably damaging Het
Vmn1r122 A G 7: 20,867,896 (GRCm39) V53A probably damaging Het
Vmn2r1 C T 3: 64,012,146 (GRCm39) T669I probably benign Het
Vmn2r86 A G 10: 130,291,726 (GRCm39) L13P probably benign Het
Zfp958 T C 8: 4,678,377 (GRCm39) I134T probably benign Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,727,328 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R1434:Kcnd2 UTSW 6 21,216,356 (GRCm39) missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21,216,395 (GRCm39) missense probably benign
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21,726,197 (GRCm39) nonsense probably null
R8465:Kcnd2 UTSW 6 21,216,695 (GRCm39) missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCCAGACACTCTGCTGG -3'
(R):5'- CGGCAATGAAGAACCCAGTC -3'

Sequencing Primer
(F):5'- TGAGAGAGACTTTTTCTACCACCCAG -3'
(R):5'- GTCACATAGTAGAACACCAGGGC -3'
Posted On 2019-05-13