Incidental Mutation 'R7010:Vmn1r122'
ID544961
Institutional Source Beutler Lab
Gene Symbol Vmn1r122
Ensembl Gene ENSMUSG00000094001
Gene Namevomeronasal 1 receptor 122
SynonymsGm5729
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location21133211-21134128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21133971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000131706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164409]
Predicted Effect probably damaging
Transcript: ENSMUST00000164409
AA Change: V53A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131706
Gene: ENSMUSG00000094001
AA Change: V53A

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 1.2e-17 PFAM
Pfam:7tm_1 31 288 1.6e-6 PFAM
Pfam:V1R 41 296 2.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Vmn1r122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Vmn1r122 APN 7 21133836 missense probably damaging 1.00
IGL01322:Vmn1r122 APN 7 21134111 missense probably benign 0.07
IGL01397:Vmn1r122 APN 7 21133782 missense possibly damaging 0.91
IGL02894:Vmn1r122 APN 7 21133724 missense probably benign
R1837:Vmn1r122 UTSW 7 21133366 missense probably benign 0.34
R3040:Vmn1r122 UTSW 7 21133446 missense probably benign
R4111:Vmn1r122 UTSW 7 21133513 missense probably damaging 1.00
R4868:Vmn1r122 UTSW 7 21133302 missense probably benign 0.01
R5239:Vmn1r122 UTSW 7 21134098 missense possibly damaging 0.69
R6851:Vmn1r122 UTSW 7 21133920 missense probably benign
R7184:Vmn1r122 UTSW 7 21133895 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTGACAAACTGATAGATACTCAGGAC -3'
(R):5'- CCGAGAAGAGTAGTGTCCTACC -3'

Sequencing Primer
(F):5'- CTGATAGATACTCAGGACACAGGTG -3'
(R):5'- GAGTAGTGTCCTACCTAATCATCCAG -3'
Posted On2019-05-13