Incidental Mutation 'R7010:Olfr487'
ID544962
Institutional Source Beutler Lab
Gene Symbol Olfr487
Ensembl Gene ENSMUSG00000095929
Gene Nameolfactory receptor 487
SynonymsMOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1, MOR204-31P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108208868-108214636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108212142 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 129 (I129N)
Ref Sequence ENSEMBL: ENSMUSP00000149407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081996] [ENSMUST00000216489]
Predicted Effect probably damaging
Transcript: ENSMUST00000081996
AA Change: I129N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080657
Gene: ENSMUSG00000095929
AA Change: I129N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 6.1e-50 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216489
AA Change: I129N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Olfr487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr487 APN 7 108211726 missense probably benign 0.06
IGL03133:Olfr487 APN 7 108212387 missense possibly damaging 0.94
IGL03326:Olfr487 APN 7 108211630 missense probably benign 0.03
R0141:Olfr487 UTSW 7 108212003 missense possibly damaging 0.59
R0344:Olfr487 UTSW 7 108211742 nonsense probably null
R0595:Olfr487 UTSW 7 108211661 missense probably damaging 1.00
R1427:Olfr487 UTSW 7 108212094 missense probably benign 0.07
R2023:Olfr487 UTSW 7 108211842 missense probably damaging 1.00
R2065:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R2068:Olfr487 UTSW 7 108212340 missense probably damaging 0.98
R3410:Olfr487 UTSW 7 108212283 missense possibly damaging 0.95
R4024:Olfr487 UTSW 7 108211742 nonsense probably null
R4619:Olfr487 UTSW 7 108212094 missense possibly damaging 0.78
R4738:Olfr487 UTSW 7 108211994 missense probably damaging 0.99
R5004:Olfr487 UTSW 7 108212116 nonsense probably null
R5684:Olfr487 UTSW 7 108212072 nonsense probably null
R6782:Olfr487 UTSW 7 108212463 missense probably benign 0.03
R6889:Olfr487 UTSW 7 108211918 missense probably benign 0.00
R7076:Olfr487 UTSW 7 108211998 missense probably damaging 1.00
R8162:Olfr487 UTSW 7 108211788 missense probably damaging 1.00
R8190:Olfr487 UTSW 7 108211807 missense possibly damaging 0.80
Z1177:Olfr487 UTSW 7 108211969 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTGTGAATGAGCCTGCAG -3'
(R):5'- CCACTTGGCTTCTGTTGATATG -3'

Sequencing Primer
(F):5'- TTCTGAGATACTCACATCAGAACAGG -3'
(R):5'- CTGTTGATATGGGCCTTTCATC -3'
Posted On2019-05-13