Incidental Mutation 'R7010:Gmip'
ID544965
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69811400 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 137 (A137T)
Ref Sequence ENSEMBL: ENSMUSP00000116542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326] [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably benign
Transcript: ENSMUST00000034326
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000036074
AA Change: A137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: A137T

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000123453
AA Change: A137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: A137T

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1692:Gmip UTSW 8 69813903 missense probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5512:Gmip UTSW 8 69817890 missense probably benign 0.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6787:Gmip UTSW 8 69813786 missense probably damaging 1.00
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6852:Gmip UTSW 8 69817991 nonsense probably null
R6934:Gmip UTSW 8 69820926 missense probably benign
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 intron probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
R8018:Gmip UTSW 8 69815493 missense probably benign 0.41
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATTCGGACCAAGGGTG -3'
(R):5'- AGGTCATGCTCCAGAAACAAG -3'

Sequencing Primer
(F):5'- TGCCCTGGAGTATGCTAAAGC -3'
(R):5'- TCAGGAACTGACCGGATT -3'
Posted On2019-05-13