Incidental Mutation 'R7010:Dlat'
ID544967
Institutional Source Beutler Lab
Gene Symbol Dlat
Ensembl Gene ENSMUSG00000000168
Gene Namedihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
SynonymsPDC-E2, 6332404G05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50634633-50659780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50657974 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 176 (K176N)
Ref Sequence ENSEMBL: ENSMUSP00000034567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000034567] [ENSMUST00000117646]
Predicted Effect probably benign
Transcript: ENSMUST00000034566
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034567
AA Change: K176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034567
Gene: ENSMUSG00000000168
AA Change: K176N

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 91 164 4.3e-17 PFAM
low complexity region 183 210 N/A INTRINSIC
Pfam:Biotin_lipoyl 218 292 1.2e-17 PFAM
low complexity region 315 344 N/A INTRINSIC
Pfam:E3_binding 350 385 2.6e-18 PFAM
Pfam:2-oxoacid_dh 412 642 9.9e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117646
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Dlat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Dlat APN 9 50645032 splice site probably benign
IGL00870:Dlat APN 9 50650869 missense probably damaging 1.00
R0440:Dlat UTSW 9 50645119 splice site probably null
R0530:Dlat UTSW 9 50637569 missense probably damaging 1.00
R0745:Dlat UTSW 9 50653708 missense probably damaging 0.99
R1870:Dlat UTSW 9 50637574 missense probably damaging 0.99
R3237:Dlat UTSW 9 50638031 missense possibly damaging 0.81
R3696:Dlat UTSW 9 50650876 missense possibly damaging 0.63
R3715:Dlat UTSW 9 50638054 missense probably damaging 1.00
R3924:Dlat UTSW 9 50658190 missense possibly damaging 0.55
R4016:Dlat UTSW 9 50649631 critical splice donor site probably null
R4197:Dlat UTSW 9 50636526 missense probably damaging 1.00
R4713:Dlat UTSW 9 50644481 missense probably benign
R4789:Dlat UTSW 9 50659370 missense probably benign
R5893:Dlat UTSW 9 50644139 splice site probably benign
R6138:Dlat UTSW 9 50645117 splice site probably null
R6778:Dlat UTSW 9 50650857 missense probably damaging 1.00
R8065:Dlat UTSW 9 50657849 missense possibly damaging 0.67
U15987:Dlat UTSW 9 50645117 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAACAAGTCACCAGGAGCCG -3'
(R):5'- CCAGAGATGTTCCAGTTGGGTC -3'

Sequencing Primer
(F):5'- AGGAGCCGGCACTCAGAG -3'
(R):5'- GGGTCCATCATCTGTATCACAGTTG -3'
Posted On2019-05-13