Incidental Mutation 'R7010:Ano10'
ID544968
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122253124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 494 (T494A)
Ref Sequence ENSEMBL: ENSMUSP00000150161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]
Predicted Effect probably damaging
Transcript: ENSMUST00000042546
AA Change: T494A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: T494A

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214283
Predicted Effect probably damaging
Transcript: ENSMUST00000214409
AA Change: T436A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214507
AA Change: T302A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Predicted Effect probably damaging
Transcript: ENSMUST00000216670
AA Change: T494A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R1801:Ano10 UTSW 9 122253030 missense probably damaging 1.00
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4027:Ano10 UTSW 9 122252928 splice site probably benign
R4151:Ano10 UTSW 9 122261535 nonsense probably null
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R4676:Ano10 UTSW 9 122263787 missense probably damaging 0.98
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6449:Ano10 UTSW 9 122201688 intron probably benign
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGGTTCTGCAAATGGCC -3'
(R):5'- GTTGGTTCAAGTGGATATCATCAG -3'

Sequencing Primer
(F):5'- CAAATGGCCGTTTGAAGACCCTG -3'
(R):5'- GATTCCTTATTTCAGCAACTTAGTGC -3'
Posted On2019-05-13