Mutagenetix > Incidental Mutations

Incidental Mutation 'R7010:Ano10'

544968

Institutional Source

Beutler Lab

Gene Symbol

Ano10

Ensembl Gene

ENSMUSG00000037949

Gene Name

anoctamin 10

Synonyms

Tmem16k

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R7010 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122175874-122294423 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122253124 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 494 (T494A)

Ref Sequence

ENSEMBL: ENSMUSP00000150161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042546
AA Change: T494A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: T494A

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	200	628	2.2e-115	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214283

Predicted Effect

probably damaging
Transcript: ENSMUST00000214409
AA Change: T436A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214507
AA Change: T302A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000216081

Predicted Effect

probably damaging
Transcript: ENSMUST00000216670
AA Change: T494A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	C	6: 41,032,313	S196A	probably benign	Het
AL592187.3	A	T	15: 77,602,597	Y58F	probably benign	Het
Asah2	A	T	19: 32,054,554	F72I	probably benign	Het
Atat1	T	C	17: 35,908,630	D114G	probably damaging	Het
Atp6v1e2	C	T	17: 86,944,345	M208I	probably benign	Het
Bicd1	A	G	6: 149,494,615	Y161C	probably damaging	Het
Camk2g	T	C	14: 20,741,444	S410G	probably benign	Het
Car2	C	T	3: 14,900,053	P249L	possibly damaging	Het
Cdh23	T	G	10: 60,530,991	I237L	probably benign	Het
Dlat	T	A	9: 50,657,974	K176N	probably damaging	Het
Dnajc12	T	A	10: 63,397,280	C67S	probably benign	Het
Fat1	G	T	8: 44,953,349	E1046*	probably null	Het
Gmip	G	A	8: 69,811,400	A137T	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grk6	A	G	13: 55,450,300	I62V	possibly damaging	Het
Hook1	G	T	4: 96,014,811	L512F	probably damaging	Het
Ighe	T	C	12: 113,273,141	T36A		Het
Il17rc	A	G	6: 113,479,288	N338S	possibly damaging	Het
Itgb6	T	C	2: 60,649,978	Y338C	probably damaging	Het
Kcnd2	A	G	6: 21,216,708	Y137C	probably damaging	Het
L3mbtl3	T	A	10: 26,282,861		probably null	Het
Lcn3	T	C	2: 25,766,056	F41S	probably damaging	Het
Map3k8	T	C	18: 4,334,060	H344R	probably damaging	Het
Marf1	A	T	16: 14,137,001	I884N	probably damaging	Het
Nalcn	G	A	14: 123,293,465	T1387I	probably damaging	Het
Nrros	T	C	16: 32,143,580	T540A	probably damaging	Het
Olfr487	A	T	7: 108,212,142	I129N	probably damaging	Het
Pank2	T	C	2: 131,280,373	Y273H	probably benign	Het
Pgrmc2	A	G	3: 41,082,633	V121A	probably damaging	Het
Phldb2	C	T	16: 45,751,505	V1175M	probably damaging	Het
Ranbp2	A	G	10: 58,454,571		probably null	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Syt7	A	G	19: 10,417,990	T55A	probably benign	Het
Tfcp2l1	T	C	1: 118,653,727	S137P	probably damaging	Het
Tom1	T	A	8: 75,051,975	V140D	probably damaging	Het
Ttc23l	T	G	15: 10,515,138	I385L	probably damaging	Het
Vmn1r122	A	G	7: 21,133,971	V53A	probably damaging	Het
Vmn2r1	C	T	3: 64,104,725	T669I	probably benign	Het
Vmn2r86	A	G	10: 130,455,857	L13P	probably benign	Het
Zfp958	T	C	8: 4,628,377	I134T	probably benign	Het

Other mutations in Ano10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00545:Ano10	APN	9	122261356	missense	possibly damaging	0.96
IGL00886:Ano10	APN	9	122271324	missense	probably benign	0.01
IGL00932:Ano10	APN	9	122251231	nonsense	probably null
IGL01613:Ano10	APN	9	122259540	missense	possibly damaging	0.75
IGL02109:Ano10	APN	9	122261342	missense	probably damaging	1.00
IGL02397:Ano10	APN	9	122261392	missense	probably damaging	1.00
IGL02512:Ano10	APN	9	122272474	missense	possibly damaging	0.50
IGL03216:Ano10	APN	9	122257061	missense	probably damaging	1.00
arna	UTSW	9	122259564	missense	possibly damaging	0.77
R0624:Ano10	UTSW	9	122259595	splice site	probably benign
R1669:Ano10	UTSW	9	122257183	missense	possibly damaging	0.94
R1801:Ano10	UTSW	9	122253030	missense	probably damaging	1.00
R2511:Ano10	UTSW	9	122258945	missense	probably damaging	0.99
R3836:Ano10	UTSW	9	122263763	missense	possibly damaging	0.58
R4027:Ano10	UTSW	9	122252928	splice site	probably benign
R4151:Ano10	UTSW	9	122261535	nonsense	probably null
R4590:Ano10	UTSW	9	122257165	missense	probably benign	0.22
R4651:Ano10	UTSW	9	122261115	nonsense	probably null
R4652:Ano10	UTSW	9	122261115	nonsense	probably null
R4676:Ano10	UTSW	9	122263787	missense	probably damaging	0.98
R5026:Ano10	UTSW	9	122272559	nonsense	probably null
R5281:Ano10	UTSW	9	122261486	missense	probably damaging	1.00
R5401:Ano10	UTSW	9	122261290	missense	probably damaging	1.00
R6269:Ano10	UTSW	9	122261242	missense	probably damaging	0.99
R6449:Ano10	UTSW	9	122201688	intron	probably benign
R6702:Ano10	UTSW	9	122259564	missense	possibly damaging	0.77
R7384:Ano10	UTSW	9	122176343	missense	unknown
R7584:Ano10	UTSW	9	122275531	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAGGTTCTGCAAATGGCC -3'
(R):5'- GTTGGTTCAAGTGGATATCATCAG -3'

Sequencing Primer
(F):5'- CAAATGGCCGTTTGAAGACCCTG -3'
(R):5'- GATTCCTTATTTCAGCAACTTAGTGC -3'

Posted On

2019-05-13