Incidental Mutation 'R7010:Dnajc12'
ID544972
Institutional Source Beutler Lab
Gene Symbol Dnajc12
Ensembl Gene ENSMUSG00000036764
Gene NameDnaJ heat shock protein family (Hsp40) member C12
SynonymsJ domain protein 1, Jdp1, mJDP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location63382443-63410576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63397280 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 67 (C67S)
Ref Sequence ENSEMBL: ENSMUSP00000041298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043317] [ENSMUST00000129625]
Predicted Effect probably benign
Transcript: ENSMUST00000043317
AA Change: C67S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041298
Gene: ENSMUSG00000036764
AA Change: C67S

DomainStartEndE-ValueType
DnaJ 13 71 1.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129625
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subclass of the HSP40/DnaJ protein family. Members of this family of proteins are associated with complex assembly, protein folding, and export. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Dnajc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Dnajc12 APN 10 63395830 missense probably damaging 1.00
IGL02276:Dnajc12 APN 10 63408258 missense probably damaging 1.00
IGL02669:Dnajc12 APN 10 63397292 missense probably damaging 0.99
R1473:Dnajc12 UTSW 10 63397244 missense probably benign 0.01
R2321:Dnajc12 UTSW 10 63407211 splice site probably benign
R4391:Dnajc12 UTSW 10 63407059 missense probably benign 0.02
R4703:Dnajc12 UTSW 10 63386650 splice site probably null
R4726:Dnajc12 UTSW 10 63397308 missense probably damaging 1.00
R5004:Dnajc12 UTSW 10 63386707 missense probably benign 0.00
R6291:Dnajc12 UTSW 10 63397274 missense probably benign 0.00
R6908:Dnajc12 UTSW 10 63397325 missense probably benign 0.00
R7696:Dnajc12 UTSW 10 63407132 missense probably benign
R7812:Dnajc12 UTSW 10 63407126 missense probably benign 0.00
Z1177:Dnajc12 UTSW 10 63397260 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGACACTAAAGCCTGACTAG -3'
(R):5'- ATGACTTACCACTAATTTCTCAGCC -3'

Sequencing Primer
(F):5'- CACTAAAGCCTGACTAGGGAGAC -3'
(R):5'- ACCACTAATTTCTCAGCCCCTTTC -3'
Posted On2019-05-13