Incidental Mutation 'R7010:Camk2g'
ID544977
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Namecalcium/calmodulin-dependent protein kinase II gamma
SynonymsCaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location20734875-20794088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20741444 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 410 (S410G)
Ref Sequence ENSEMBL: ENSMUSP00000154158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000223863] [ENSMUST00000224887] [ENSMUST00000225328] [ENSMUST00000225609] [ENSMUST00000226630]
Predicted Effect probably benign
Transcript: ENSMUST00000071816
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080440
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100837
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000223863
Predicted Effect probably benign
Transcript: ENSMUST00000224887
Predicted Effect probably benign
Transcript: ENSMUST00000225328
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000225609
Predicted Effect probably benign
Transcript: ENSMUST00000226630
AA Change: S410G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0047:Camk2g UTSW 14 20771068 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R0783:Camk2g UTSW 14 20744636 missense possibly damaging 0.56
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R2380:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5613:Camk2g UTSW 14 20737491 missense probably damaging 0.98
R5763:Camk2g UTSW 14 20739347 missense probably damaging 1.00
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
R7655:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R7656:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
Z1176:Camk2g UTSW 14 20764912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAAGCTGACTGACAGGC -3'
(R):5'- CACCTTTGTAGCGTTCCCAGAC -3'

Sequencing Primer
(F):5'- CAGCTGGGCTAGGCTGACTG -3'
(R):5'- CTCTCTGGCAGAGGTAGCTGAG -3'
Posted On2019-05-13