Incidental Mutation 'R7010:Nrros'
ID544982
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Namenegative regulator of reactive oxygen species
SynonymsLrrc33, E430025L02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location32142785-32165594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32143580 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 540 (T540A)
Ref Sequence ENSEMBL: ENSMUSP00000110817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099991
AA Change: T512A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: T512A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115163
AA Change: T540A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: T540A

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115165
AA Change: T488A

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: T488A

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126869
AA Change: T512A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: T512A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143682
AA Change: T512A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: T512A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231836
AA Change: T504A

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atat1 T C 17: 35,908,630 D114G probably damaging Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 32147620 missense probably benign 0.06
IGL01097:Nrros APN 16 32144185 missense possibly damaging 0.71
IGL02065:Nrros APN 16 32144674 missense possibly damaging 0.84
IGL03372:Nrros APN 16 32144770 missense probably damaging 1.00
R0615:Nrros UTSW 16 32144085 missense probably damaging 1.00
R0669:Nrros UTSW 16 32143423 missense probably damaging 1.00
R0840:Nrros UTSW 16 32143423 missense probably damaging 1.00
R1398:Nrros UTSW 16 32143144 missense probably damaging 0.98
R1796:Nrros UTSW 16 32143511 missense probably damaging 1.00
R2031:Nrros UTSW 16 32144157 nonsense probably null
R2033:Nrros UTSW 16 32144157 nonsense probably null
R2034:Nrros UTSW 16 32144157 nonsense probably null
R2087:Nrros UTSW 16 32144157 nonsense probably null
R2089:Nrros UTSW 16 32144157 nonsense probably null
R2090:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2151:Nrros UTSW 16 32143258 missense probably benign 0.11
R2438:Nrros UTSW 16 32144111 unclassified probably null
R2438:Nrros UTSW 16 32144299 missense probably benign 0.25
R5474:Nrros UTSW 16 32144352 missense probably benign 0.00
R5527:Nrros UTSW 16 32144470 missense probably damaging 1.00
R5629:Nrros UTSW 16 32144405 missense probably damaging 1.00
R5888:Nrros UTSW 16 32143087 missense probably benign 0.15
R5939:Nrros UTSW 16 32143454 missense probably benign 0.01
R5982:Nrros UTSW 16 32144593 missense probably damaging 0.96
R6869:Nrros UTSW 16 32144431 missense probably damaging 1.00
R6912:Nrros UTSW 16 32162239 missense probably null 0.01
R7469:Nrros UTSW 16 32144212 missense probably benign 0.14
R7673:Nrros UTSW 16 32162281 missense unknown
R7770:Nrros UTSW 16 32143528 missense probably benign 0.01
R7948:Nrros UTSW 16 32162258 missense unknown
X0022:Nrros UTSW 16 32143040 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGAGAGTTTCTGCGGAGGTC -3'
(R):5'- GTCACAATCAGATCTCACTTTGTC -3'

Sequencing Primer
(F):5'- TCTGCGGAGGTCGAGAGTC -3'
(R):5'- TCAGATGGTGCCCGTAGACTG -3'
Posted On2019-05-13