Incidental Mutation 'R7010:Atat1'
ID544984
Institutional Source Beutler Lab
Gene Symbol Atat1
Ensembl Gene ENSMUSG00000024426
Gene Namealpha tubulin acetyltransferase 1
Synonyms2610110G12Rik, 0610011P08Rik, 3110080J08Rik, 2610008K08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R7010 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35897595-35910075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35908630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 114 (D114G)
Ref Sequence ENSEMBL: ENSMUSP00000117824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025305] [ENSMUST00000056034] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000113782] [ENSMUST00000141132] [ENSMUST00000141662] [ENSMUST00000149277] [ENSMUST00000174807]
Predicted Effect probably benign
Transcript: ENSMUST00000025305
SMART Domains Protein: ENSMUSP00000025305
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 109 161 8.1e-18 PFAM
low complexity region 196 207 N/A INTRINSIC
low complexity region 208 217 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000056034
AA Change: D157G

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053853
Gene: ENSMUSG00000024426
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061052
AA Change: D157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077494
AA Change: D157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113782
SMART Domains Protein: ENSMUSP00000109412
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 18 69 5.1e-16 PFAM
low complexity region 104 115 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 132 153 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426
AA Change: D48G

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137182
Predicted Effect probably benign
Transcript: ENSMUST00000140292
SMART Domains Protein: ENSMUSP00000119039
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
PDB:4GS4|A 2 36 9e-13 PDB
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141132
AA Change: D114G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117824
Gene: ENSMUSG00000024426
AA Change: D114G

DomainStartEndE-ValueType
Pfam:Mec-17 29 149 9.1e-59 PFAM
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141662
AA Change: D157G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115004
Gene: ENSMUSG00000024426
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 1.7e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149277
AA Change: D157G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426
AA Change: D157G

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172642
Predicted Effect probably benign
Transcript: ENSMUST00000174349
Predicted Effect probably benign
Transcript: ENSMUST00000174807
SMART Domains Protein: ENSMUSP00000133584
Gene: ENSMUSG00000024436

DomainStartEndE-ValueType
SCOP:d1fjgr_ 91 128 1e-8 SMART
low complexity region 130 141 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired alpha tubulin acetylation and abnormal dentate gyrus morphology. Mice homozygous for a different knock-out allele exhibit reduced male fertility associated with teratozoospermia, oligozoospermia andasthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,032,313 S196A probably benign Het
AL592187.3 A T 15: 77,602,597 Y58F probably benign Het
Ano10 T C 9: 122,253,124 T494A probably damaging Het
Asah2 A T 19: 32,054,554 F72I probably benign Het
Atp6v1e2 C T 17: 86,944,345 M208I probably benign Het
Bicd1 A G 6: 149,494,615 Y161C probably damaging Het
Camk2g T C 14: 20,741,444 S410G probably benign Het
Car2 C T 3: 14,900,053 P249L possibly damaging Het
Cdh23 T G 10: 60,530,991 I237L probably benign Het
Dlat T A 9: 50,657,974 K176N probably damaging Het
Dnajc12 T A 10: 63,397,280 C67S probably benign Het
Fat1 G T 8: 44,953,349 E1046* probably null Het
Gmip G A 8: 69,811,400 A137T probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grk6 A G 13: 55,450,300 I62V possibly damaging Het
Hook1 G T 4: 96,014,811 L512F probably damaging Het
Ighe T C 12: 113,273,141 T36A Het
Il17rc A G 6: 113,479,288 N338S possibly damaging Het
Itgb6 T C 2: 60,649,978 Y338C probably damaging Het
Kcnd2 A G 6: 21,216,708 Y137C probably damaging Het
L3mbtl3 T A 10: 26,282,861 probably null Het
Lcn3 T C 2: 25,766,056 F41S probably damaging Het
Map3k8 T C 18: 4,334,060 H344R probably damaging Het
Marf1 A T 16: 14,137,001 I884N probably damaging Het
Nalcn G A 14: 123,293,465 T1387I probably damaging Het
Nrros T C 16: 32,143,580 T540A probably damaging Het
Olfr487 A T 7: 108,212,142 I129N probably damaging Het
Pank2 T C 2: 131,280,373 Y273H probably benign Het
Pgrmc2 A G 3: 41,082,633 V121A probably damaging Het
Phldb2 C T 16: 45,751,505 V1175M probably damaging Het
Ranbp2 A G 10: 58,454,571 probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Syt7 A G 19: 10,417,990 T55A probably benign Het
Tfcp2l1 T C 1: 118,653,727 S137P probably damaging Het
Tom1 T A 8: 75,051,975 V140D probably damaging Het
Ttc23l T G 15: 10,515,138 I385L probably damaging Het
Vmn1r122 A G 7: 21,133,971 V53A probably damaging Het
Vmn2r1 C T 3: 64,104,725 T669I probably benign Het
Vmn2r86 A G 10: 130,455,857 L13P probably benign Het
Zfp958 T C 8: 4,628,377 I134T probably benign Het
Other mutations in Atat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Atat1 APN 17 35897883 missense probably benign 0.04
IGL01903:Atat1 APN 17 35897800 missense probably benign 0.00
IGL01958:Atat1 APN 17 35908843 unclassified probably benign
IGL02725:Atat1 APN 17 35909489 missense probably benign 0.01
IGL02729:Atat1 APN 17 35898391 missense probably benign 0.00
R0633:Atat1 UTSW 17 35901423 missense probably damaging 1.00
R1541:Atat1 UTSW 17 35904331 missense probably damaging 1.00
R1944:Atat1 UTSW 17 35909340 missense probably damaging 1.00
R2054:Atat1 UTSW 17 35901369 missense probably null 0.99
R2132:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R4967:Atat1 UTSW 17 35901575 missense probably damaging 1.00
R6062:Atat1 UTSW 17 35908564 missense probably damaging 1.00
R6347:Atat1 UTSW 17 35910029 missense probably damaging 1.00
R6380:Atat1 UTSW 17 35908957 unclassified probably null
R7028:Atat1 UTSW 17 35910005 missense probably benign 0.01
R7230:Atat1 UTSW 17 35909439 missense probably damaging 1.00
R7520:Atat1 UTSW 17 35897814 missense probably benign 0.36
R7607:Atat1 UTSW 17 35909107 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAGAGCTCAGGCATAAAGTCC -3'
(R):5'- TAAAAGGCTCTTCACCCCG -3'

Sequencing Primer
(F):5'- GATCTGTGTGTTCAAGGCCAACC -3'
(R):5'- TTCACCCCGAAGCTCTAGGAG -3'
Posted On2019-05-13