Incidental Mutation 'R7011:Olfr1307'
ID545000
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7011 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111944686 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 257 (F257I)
Ref Sequence ENSEMBL: ENSMUSP00000097201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably benign
Transcript: ENSMUST00000099604
AA Change: F257I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: F257I

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099606
AA Change: F257I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: F257I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R0714:Olfr1307 UTSW 2 111944553 missense probably benign 0.01
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1733:Olfr1307 UTSW 2 111945280 missense probably benign 0.13
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5167:Olfr1307 UTSW 2 111945102 missense probably damaging 1.00
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R6877:Olfr1307 UTSW 2 111944839 missense probably benign 0.16
R7177:Olfr1307 UTSW 2 111945156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGACAGTCCATAGTACATTTAGG -3'
(R):5'- ATGTGTTGGACAGCTTCTACTG -3'

Sequencing Primer
(F):5'- AGCTGTCTGCATACTCTCT -3'
(R):5'- ACCAGCTGGAATTCATGGTC -3'
Posted On2019-05-13