Mutagenetix > Incidental Mutation

Incidental Mutation 'R7011:Olfr1307'

545000

Institutional Source

Beutler Lab

Gene Symbol

Olfr1307

Ensembl Gene

ENSMUSG00000094747

Gene Name

olfactory receptor 1307

Synonyms

MOR245-19P, GA_x6K02T2Q125-72988111-72987173

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7011 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111930116-111949440 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 111944686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 257 (F257I)

Ref Sequence

ENSEMBL: ENSMUSP00000097201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]

AlphaFold

Q7TQX1

Predicted Effect

probably benign
Transcript: ENSMUST00000099604
AA Change: F257I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: F257I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	38	311	1.5e-36	PFAM
Pfam:7tm_1	49	295	6.5e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099606
AA Change: F257I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: F257I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	305	2.2e-42	PFAM
Pfam:7tm_1	41	287	6.7e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	C	T	11: 46,143,018	P886S	probably benign	Het
Anapc1	C	T	2: 128,648,681		probably null	Het
Ankrd34c	C	A	9: 89,728,948	G447*	probably null	Het
Apbb1ip	A	T	2: 22,835,931	E238D	probably damaging	Het
Arfgap1	T	C	2: 180,972,142	L110P	probably damaging	Het
Arhgap21	G	A	2: 20,848,878	T1901I	possibly damaging	Het
Brpf1	C	A	6: 113,318,466	Q679K	probably benign	Het
Btnl2	A	G	17: 34,363,513	E351G	probably damaging	Het
Cd209f	T	A	8: 4,104,859	T80S	probably benign	Het
Cdc16	A	G	8: 13,769,451	E349G	probably damaging	Het
Cfap53	A	T	18: 74,329,493	D436V	probably benign	Het
Crhr2	A	T	6: 55,099,210		probably null	Het
Cux1	T	C	5: 136,360,033	K226E	probably damaging	Het
Ddr2	A	T	1: 169,982,103	D768E	probably damaging	Het
Dhx8	T	C	11: 101,741,520	L435P	probably damaging	Het
Dnah11	AGGCC	AGGCCGGCC	12: 117,922,018		probably null	Het
Eif4ebp1	G	A	8: 27,273,344	R55Q	probably damaging	Het
Fbxo18	T	A	2: 11,762,963	D358V	probably damaging	Het
Fra10ac1	T	A	19: 38,188,794	E304D	probably benign	Het
Gabrb2	T	C	11: 42,626,661	S399P	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gprin2	G	T	14: 34,195,436	H126N	probably null	Het
Gucy1a1	A	G	3: 82,109,115	S189P	probably damaging	Het
Htr1d	T	C	4: 136,443,006	M182T	probably benign	Het
Lipc	A	G	9: 70,818,954	F73L	probably benign	Het
Liph	A	G	16: 21,984,097	I74T	probably damaging	Het
Lrif1	T	G	3: 106,732,285	Y229D	probably damaging	Het
Magel2	C	T	7: 62,378,533	T395I	possibly damaging	Het
Magi3	T	C	3: 104,105,754	N139S	probably damaging	Het
Man2c1	T	A	9: 57,137,833	V336E	probably damaging	Het
Mapk12	A	T	15: 89,135,600	Y135N	probably damaging	Het
Mapkapk3	C	T	9: 107,289,396		probably benign	Het
Mast1	A	T	8: 84,911,945	Y653*	probably null	Het
Muc16	T	A	9: 18,637,451	I5849F	probably benign	Het
Muc16	T	A	9: 18,637,543	H5818L	probably benign	Het
Ndufa10	A	G	1: 92,470,859	S68P	probably damaging	Het
Nedd1	C	A	10: 92,690,773	L503F	probably benign	Het
Nr1i3	A	G	1: 171,214,358	M4V	probably benign	Het
Olfr1121	G	A	2: 87,372,260	A243T	possibly damaging	Het
Olfr1501	T	C	19: 13,839,039	I45V	probably benign	Het
Olfr332	T	A	11: 58,490,144	I204F	possibly damaging	Het
Papd7	C	T	13: 69,500,080	G489S	probably damaging	Het
Pcdh18	A	T	3: 49,754,782	S695T	probably benign	Het
Pcdha1	T	C	18: 36,930,535	I84T	probably damaging	Het
Plek	T	A	11: 16,994,760	D90V	possibly damaging	Het
Ppp6r1	A	G	7: 4,646,826	C47R	probably damaging	Het
Psg27	G	C	7: 18,556,873	N468K	probably benign	Het
Ptchd4	G	A	17: 42,503,868	E887K	probably benign	Het
Rabgap1	C	T	2: 37,540,480	L678F	probably damaging	Het
Rmdn3	T	C	2: 119,138,423	Y429C	probably damaging	Het
Ros1	A	T	10: 52,180,176	C73S	probably damaging	Het
Rtkn2	G	A	10: 67,979,665		probably benign	Het
Slc25a42	A	G	8: 70,186,702	S242P	probably damaging	Het
Smtnl1	T	A	2: 84,818,409	D167V	probably benign	Het
Smurf2	A	G	11: 106,833,784	L511P	probably benign	Het
Stbd1	A	T	5: 92,605,118	K156*	probably null	Het
Tenm4	G	T	7: 96,896,135	G2453*	probably null	Het
Tpr	A	G	1: 150,433,772	K1760E	probably damaging	Het
Triobp	T	A	15: 78,978,723	L1427Q	probably damaging	Het
Uaca	A	G	9: 60,870,368	E679G	probably damaging	Het
Ucn3	T	G	13: 3,941,421	H77P	possibly damaging	Het
Wnk2	T	A	13: 49,071,091	D998V	probably damaging	Het
Xrcc3	A	G	12: 111,804,535	V320A	probably damaging	Het
Zdbf2	A	G	1: 63,306,766	T1435A	possibly damaging	Het
Zfp36l2	G	T	17: 84,186,433	H259N	possibly damaging	Het
Zfp619	A	T	7: 39,537,762	H1072L	probably damaging	Het
Zfy2	T	A	Y: 2,107,127	E502D	possibly damaging	Het
Zfyve16	G	A	13: 92,521,987	P472L	probably benign	Het

Other mutations in Olfr1307

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01501:Olfr1307	APN	2	111944518	makesense	probably null
IGL01947:Olfr1307	APN	2	111944994	missense	probably benign	0.26
IGL02373:Olfr1307	APN	2	111944833	missense	probably benign	0.01
IGL02682:Olfr1307	APN	2	111944940	missense	probably damaging	1.00
R0714:Olfr1307	UTSW	2	111944553	missense	probably benign	0.01
R1670:Olfr1307	UTSW	2	111944919	missense	probably damaging	1.00
R1730:Olfr1307	UTSW	2	111945288	missense	probably benign	0.45
R1733:Olfr1307	UTSW	2	111945280	missense	probably benign	0.13
R1773:Olfr1307	UTSW	2	111944859	missense	possibly damaging	0.55
R1783:Olfr1307	UTSW	2	111945288	missense	probably benign	0.45
R2180:Olfr1307	UTSW	2	111945003	missense	probably benign	0.39
R2197:Olfr1307	UTSW	2	111945313	missense	possibly damaging	0.64
R2207:Olfr1307	UTSW	2	111944925	missense	probably damaging	1.00
R2377:Olfr1307	UTSW	2	111944643	missense	probably damaging	1.00
R4425:Olfr1307	UTSW	2	111945189	missense	probably benign	0.00
R4595:Olfr1307	UTSW	2	111944652	missense	possibly damaging	0.86
R4859:Olfr1307	UTSW	2	111944811	missense	probably damaging	0.98
R4910:Olfr1307	UTSW	2	111945078	missense	possibly damaging	0.69
R5167:Olfr1307	UTSW	2	111945102	missense	probably damaging	1.00
R5537:Olfr1307	UTSW	2	111945048	missense	probably damaging	1.00
R6328:Olfr1307	UTSW	2	111945394	missense	probably null	0.41
R6877:Olfr1307	UTSW	2	111944839	missense	probably benign	0.16
R7177:Olfr1307	UTSW	2	111945156	missense	probably damaging	1.00
R7937:Olfr1307	UTSW	2	111944530	missense	probably benign	0.00
R8792:Olfr1307	UTSW	2	111944728	missense	probably damaging	1.00
R9290:Olfr1307	UTSW	2	111944622	missense	possibly damaging	0.91
R9358:Olfr1307	UTSW	2	111945084	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CAGAAGACAGTCCATAGTACATTTAGG -3'
(R):5'- ATGTGTTGGACAGCTTCTACTG -3'

Sequencing Primer
(F):5'- AGCTGTCTGCATACTCTCT -3'
(R):5'- ACCAGCTGGAATTCATGGTC -3'

Posted On

2019-05-13