Incidental Mutation 'R7011:Pcdh18'
ID545003
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Nameprotocadherin 18
SynonymsPCDH68L
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7011 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location49743296-49757325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49754782 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 695 (S695T)
Ref Sequence ENSEMBL: ENSMUSP00000141995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
Predicted Effect probably benign
Transcript: ENSMUST00000035931
AA Change: S695T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: S695T

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191794
AA Change: S695T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: S695T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49753379 missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49755616 missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49756389 missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49756141 missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49755798 missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49753533 splice site probably benign
IGL01727:Pcdh18 APN 3 49755700 missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49755922 nonsense probably null
IGL01824:Pcdh18 APN 3 49754774 missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49756830 missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49755249 missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49744921 missense probably benign
IGL02095:Pcdh18 APN 3 49756156 missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49756686 missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49755938 missense probably benign
IGL02342:Pcdh18 APN 3 49756044 missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49744603 utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49753447 missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49756625 missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49755891 missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49753367 missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49755069 missense probably benign
R0078:Pcdh18 UTSW 3 49756344 missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49756698 unclassified probably null
R0524:Pcdh18 UTSW 3 49755642 missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49753318 missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49756803 missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49753379 missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49755405 missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49755634 missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49756405 missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49754705 missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49755447 missense probably benign
R1956:Pcdh18 UTSW 3 49755951 missense probably benign
R2044:Pcdh18 UTSW 3 49754940 missense probably benign
R2303:Pcdh18 UTSW 3 49755274 missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3733:Pcdh18 UTSW 3 49754791 missense probably benign
R3973:Pcdh18 UTSW 3 49754586 missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49756533 missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49744725 missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49756441 missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49755114 missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49744668 missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49754664 missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49754457 missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49754856 missense probably benign
R5169:Pcdh18 UTSW 3 49755966 missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49756016 nonsense probably null
R5579:Pcdh18 UTSW 3 49744977 missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49754464 missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49745251 missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49755895 missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49755915 missense probably benign 0.00
R7146:Pcdh18 UTSW 3 49755822 missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49754694 missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49755474 missense probably benign
R7326:Pcdh18 UTSW 3 49756860 missense probably benign
R7413:Pcdh18 UTSW 3 49744783 missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49754829 missense possibly damaging 0.59
R7848:Pcdh18 UTSW 3 49755997 missense possibly damaging 0.54
R7931:Pcdh18 UTSW 3 49755997 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CCTTTGTGAATCTGCCTGGATG -3'
(R):5'- CAGCTGCTCCATAGTATCTGG -3'

Sequencing Primer
(F):5'- CCTGGATGGCCTTTTAGGATG -3'
(R):5'- GGTCATGTGACATTCATACCAACGTC -3'
Posted On2019-05-13