Incidental Mutation 'R7011:Magi3'
ID 545005
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock # R7011 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 104013259-104220374 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104105754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 139 (N139S)
Ref Sequence ENSEMBL: ENSMUSP00000112934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000064371
AA Change: N139S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: N139S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: N139S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: N139S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122303
AA Change: N139S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: N139S

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 splice site probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
R7950:Magi3 UTSW 3 104016689 missense probably damaging 1.00
R8140:Magi3 UTSW 3 104034086 missense probably damaging 1.00
R8204:Magi3 UTSW 3 104051186 missense probably benign
R8229:Magi3 UTSW 3 104015701 missense possibly damaging 0.79
R8229:Magi3 UTSW 3 104015702 missense probably benign 0.00
R8260:Magi3 UTSW 3 104015309 missense probably benign 0.01
R8348:Magi3 UTSW 3 104051215 missense probably damaging 1.00
R8368:Magi3 UTSW 3 104095063 critical splice donor site probably null
R8543:Magi3 UTSW 3 104219668 missense probably damaging 0.98
R8762:Magi3 UTSW 3 104050853 missense probably damaging 1.00
R8826:Magi3 UTSW 3 104085346 missense probably benign 0.00
R8847:Magi3 UTSW 3 104015018 missense probably benign 0.09
R8892:Magi3 UTSW 3 104050825 missense probably damaging 1.00
R8939:Magi3 UTSW 3 104089432 intron probably benign
R9090:Magi3 UTSW 3 104015948 missense possibly damaging 0.68
R9187:Magi3 UTSW 3 104015757 missense possibly damaging 0.76
R9271:Magi3 UTSW 3 104015948 missense possibly damaging 0.68
R9433:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9439:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9557:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9557:Magi3 UTSW 3 104017617 missense probably damaging 1.00
R9697:Magi3 UTSW 3 104049142 critical splice donor site probably null
R9796:Magi3 UTSW 3 104020975 missense probably benign
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATGTACCTCAATGCAGGAG -3'
(R):5'- CCATGTCCTGTTATTAACCAAAGG -3'

Sequencing Primer
(F):5'- CATGTACCTCAATGCAGGAGAATATG -3'
(R):5'- CTCTCTTTTTTGTAGGCAAAG -3'
Posted On 2019-05-13