Incidental Mutation 'R7011:Magel2'
ID545015
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7011 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62378533 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 395 (T395I)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080403
AA Change: T395I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: T395I

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
R7836:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
R7919:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Z1177:Magel2 UTSW 7 62379607 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAGCCTTTGATCCTACAAATC -3'
(R):5'- CTTGCTATGCCATGTGGAGC -3'

Sequencing Primer
(F):5'- TCCAGTCTCAAGTCATAAGGGCTC -3'
(R):5'- CTGATAGGGACCTGTCGGATCAG -3'
Posted On2019-05-13