Incidental Mutation 'R7011:Rtkn2'
ID545030
Institutional Source Beutler Lab
Gene Symbol Rtkn2
Ensembl Gene ENSMUSG00000037846
Gene Namerhotekin 2
SynonymsPlekhk1, B130039D23Rik, RTKN2, Mbf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7011 (G1)
Quality Score163.009
Status Validated
Chromosome10
Chromosomal Location67979570-68059740 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 67979665 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068994] [ENSMUST00000105437] [ENSMUST00000117086] [ENSMUST00000118160] [ENSMUST00000147556]
Predicted Effect probably benign
Transcript: ENSMUST00000068994
SMART Domains Protein: ENSMUSP00000070717
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 93 243 4.9e-37 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105437
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117086
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118160
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147556
SMART Domains Protein: ENSMUSP00000116166
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Triobp T A 15: 78,978,723 L1427Q probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Rtkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rtkn2 APN 10 68041664 missense probably benign 0.00
IGL01338:Rtkn2 APN 10 68025519 missense possibly damaging 0.83
IGL01865:Rtkn2 APN 10 68035875 missense probably benign 0.44
IGL03074:Rtkn2 APN 10 68041721 missense probably damaging 0.99
IGL03383:Rtkn2 APN 10 68017837 missense probably damaging 1.00
PIT4520001:Rtkn2 UTSW 10 67987461 missense probably damaging 1.00
R1167:Rtkn2 UTSW 10 67997620 missense probably damaging 1.00
R2166:Rtkn2 UTSW 10 68041696 missense possibly damaging 0.55
R2323:Rtkn2 UTSW 10 68001934 missense probably damaging 1.00
R3826:Rtkn2 UTSW 10 67997626 splice site probably null
R3827:Rtkn2 UTSW 10 67997626 splice site probably null
R3828:Rtkn2 UTSW 10 67997626 splice site probably null
R3829:Rtkn2 UTSW 10 67997626 splice site probably null
R4742:Rtkn2 UTSW 10 68003314 missense possibly damaging 0.72
R4867:Rtkn2 UTSW 10 68001927 missense probably damaging 0.99
R4871:Rtkn2 UTSW 10 68005633 missense probably damaging 1.00
R4936:Rtkn2 UTSW 10 68041915 makesense probably null
R5009:Rtkn2 UTSW 10 68041409 missense probably benign 0.14
R5709:Rtkn2 UTSW 10 68001970 missense probably benign 0.31
R6295:Rtkn2 UTSW 10 67979699 start gained probably benign
R6307:Rtkn2 UTSW 10 68035832 missense possibly damaging 0.60
R6751:Rtkn2 UTSW 10 68041453 missense probably benign 0.43
R6823:Rtkn2 UTSW 10 68026632 missense probably damaging 0.96
R7369:Rtkn2 UTSW 10 68041429 missense probably damaging 0.96
R7403:Rtkn2 UTSW 10 68005636 missense probably benign 0.18
R7760:Rtkn2 UTSW 10 68005609 missense probably damaging 1.00
R7803:Rtkn2 UTSW 10 67979813 critical splice donor site probably null
R7992:Rtkn2 UTSW 10 68040093 missense probably damaging 1.00
Z1177:Rtkn2 UTSW 10 68025603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTTCTATGGCGAGCCTTC -3'
(R):5'- TTGCATTACACGCCCAGCTG -3'

Sequencing Primer
(F):5'- CTATGGCGAGCCTTCTCTAAG -3'
(R):5'- TGCAAGCCTTGGAAGACC -3'
Posted On2019-05-13