Incidental Mutation 'R7011:Nedd1'
ID 545031
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 045112-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7011 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 92520608-92558282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92526635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 503 (L503F)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
AlphaFold P33215
Predicted Effect probably benign
Transcript: ENSMUST00000020163
AA Change: L503F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: L503F

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,033,845 (GRCm39) P886S probably benign Het
Anapc1 C T 2: 128,490,601 (GRCm39) probably null Het
Ankrd34c C A 9: 89,611,001 (GRCm39) G447* probably null Het
Apbb1ip A T 2: 22,725,943 (GRCm39) E238D probably damaging Het
Arfgap1 T C 2: 180,613,935 (GRCm39) L110P probably damaging Het
Arhgap21 G A 2: 20,853,689 (GRCm39) T1901I possibly damaging Het
Brpf1 C A 6: 113,295,427 (GRCm39) Q679K probably benign Het
Btnl2 A G 17: 34,582,487 (GRCm39) E351G probably damaging Het
Cd209f T A 8: 4,154,859 (GRCm39) T80S probably benign Het
Cdc16 A G 8: 13,819,451 (GRCm39) E349G probably damaging Het
Cfap53 A T 18: 74,462,564 (GRCm39) D436V probably benign Het
Crhr2 A T 6: 55,076,195 (GRCm39) probably null Het
Cux1 T C 5: 136,388,887 (GRCm39) K226E probably damaging Het
Ddr2 A T 1: 169,809,672 (GRCm39) D768E probably damaging Het
Dhx8 T C 11: 101,632,346 (GRCm39) L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,885,753 (GRCm39) probably null Het
Eif4ebp1 G A 8: 27,763,372 (GRCm39) R55Q probably damaging Het
Fbh1 T A 2: 11,767,774 (GRCm39) D358V probably damaging Het
Fra10ac1 T A 19: 38,177,242 (GRCm39) E304D probably benign Het
Gabrb2 T C 11: 42,517,488 (GRCm39) S399P possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Gprin2 G T 14: 33,917,393 (GRCm39) H126N probably null Het
Gucy1a1 A G 3: 82,016,422 (GRCm39) S189P probably damaging Het
Htr1d T C 4: 136,170,317 (GRCm39) M182T probably benign Het
Lipc A G 9: 70,726,236 (GRCm39) F73L probably benign Het
Liph A G 16: 21,802,847 (GRCm39) I74T probably damaging Het
Lrif1 T G 3: 106,639,601 (GRCm39) Y229D probably damaging Het
Magel2 C T 7: 62,028,281 (GRCm39) T395I possibly damaging Het
Magi3 T C 3: 104,013,070 (GRCm39) N139S probably damaging Het
Man2c1 T A 9: 57,045,117 (GRCm39) V336E probably damaging Het
Mapk12 A T 15: 89,019,803 (GRCm39) Y135N probably damaging Het
Mapkapk3 C T 9: 107,166,595 (GRCm39) probably benign Het
Mast1 A T 8: 85,638,574 (GRCm39) Y653* probably null Het
Muc16 T A 9: 18,548,839 (GRCm39) H5818L probably benign Het
Muc16 T A 9: 18,548,747 (GRCm39) I5849F probably benign Het
Ndufa10 A G 1: 92,398,581 (GRCm39) S68P probably damaging Het
Nr1i3 A G 1: 171,041,927 (GRCm39) M4V probably benign Het
Or12e9 G A 2: 87,202,604 (GRCm39) A243T possibly damaging Het
Or2av9 T A 11: 58,380,970 (GRCm39) I204F possibly damaging Het
Or4f14b A T 2: 111,775,031 (GRCm39) F257I probably benign Het
Or9i2 T C 19: 13,816,403 (GRCm39) I45V probably benign Het
Pcdh18 A T 3: 49,709,231 (GRCm39) S695T probably benign Het
Pcdha1 T C 18: 37,063,588 (GRCm39) I84T probably damaging Het
Plek T A 11: 16,944,760 (GRCm39) D90V possibly damaging Het
Ppp6r1 A G 7: 4,649,825 (GRCm39) C47R probably damaging Het
Psg27 G C 7: 18,290,798 (GRCm39) N468K probably benign Het
Ptchd4 G A 17: 42,814,759 (GRCm39) E887K probably benign Het
Rabgap1 C T 2: 37,430,492 (GRCm39) L678F probably damaging Het
Rmdn3 T C 2: 118,968,904 (GRCm39) Y429C probably damaging Het
Ros1 A T 10: 52,056,272 (GRCm39) C73S probably damaging Het
Rtkn2 G A 10: 67,815,495 (GRCm39) probably benign Het
Slc25a42 A G 8: 70,639,352 (GRCm39) S242P probably damaging Het
Smtnl1 T A 2: 84,648,753 (GRCm39) D167V probably benign Het
Smurf2 A G 11: 106,724,610 (GRCm39) L511P probably benign Het
Stbd1 A T 5: 92,752,977 (GRCm39) K156* probably null Het
Tenm4 G T 7: 96,545,342 (GRCm39) G2453* probably null Het
Tent4a C T 13: 69,648,199 (GRCm39) G489S probably damaging Het
Tpr A G 1: 150,309,523 (GRCm39) K1760E probably damaging Het
Triobp T A 15: 78,862,923 (GRCm39) L1427Q probably damaging Het
Uaca A G 9: 60,777,650 (GRCm39) E679G probably damaging Het
Ucn3 T G 13: 3,991,421 (GRCm39) H77P possibly damaging Het
Wnk2 T A 13: 49,224,567 (GRCm39) D998V probably damaging Het
Xrcc3 A G 12: 111,770,969 (GRCm39) V320A probably damaging Het
Zdbf2 A G 1: 63,345,925 (GRCm39) T1435A possibly damaging Het
Zfp36l2 G T 17: 84,493,861 (GRCm39) H259N possibly damaging Het
Zfp619 A T 7: 39,187,186 (GRCm39) H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 (GRCm39) E502D possibly damaging Het
Zfyve16 G A 13: 92,658,495 (GRCm39) P472L probably benign Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92,530,836 (GRCm39) splice site probably benign
IGL00988:Nedd1 APN 10 92,525,548 (GRCm39) missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92,534,031 (GRCm39) critical splice donor site probably null
IGL01588:Nedd1 APN 10 92,522,124 (GRCm39) missense probably benign 0.12
IGL01988:Nedd1 APN 10 92,550,021 (GRCm39) missense probably benign 0.39
IGL02706:Nedd1 APN 10 92,522,147 (GRCm39) missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92,525,519 (GRCm39) nonsense probably null
IGL03011:Nedd1 APN 10 92,525,503 (GRCm39) missense possibly damaging 0.92
Brainless UTSW 10 92,526,635 (GRCm39) missense probably benign 0.01
R0125:Nedd1 UTSW 10 92,527,791 (GRCm39) missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92,534,745 (GRCm39) missense probably benign 0.30
R0244:Nedd1 UTSW 10 92,552,127 (GRCm39) intron probably benign
R0645:Nedd1 UTSW 10 92,527,693 (GRCm39) splice site probably null
R0791:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92,536,660 (GRCm39) missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92,555,476 (GRCm39) missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92,534,601 (GRCm39) missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92,550,022 (GRCm39) missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92,555,465 (GRCm39) missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92,549,988 (GRCm39) missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92,530,860 (GRCm39) missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92,555,444 (GRCm39) missense probably benign 0.00
R4798:Nedd1 UTSW 10 92,534,772 (GRCm39) missense probably benign 0.00
R4830:Nedd1 UTSW 10 92,522,120 (GRCm39) missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92,530,893 (GRCm39) missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92,547,074 (GRCm39) missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92,522,102 (GRCm39) missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92,552,054 (GRCm39) missense probably benign 0.04
R5534:Nedd1 UTSW 10 92,530,894 (GRCm39) missense probably benign 0.01
R6045:Nedd1 UTSW 10 92,530,962 (GRCm39) nonsense probably null
R6154:Nedd1 UTSW 10 92,534,104 (GRCm39) missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92,527,737 (GRCm39) missense probably benign
R6692:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92,534,199 (GRCm39) missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92,547,168 (GRCm39) missense probably damaging 1.00
R7406:Nedd1 UTSW 10 92,547,185 (GRCm39) splice site probably null
R7455:Nedd1 UTSW 10 92,536,787 (GRCm39) missense probably benign 0.01
R7587:Nedd1 UTSW 10 92,534,592 (GRCm39) missense probably benign 0.01
R7745:Nedd1 UTSW 10 92,550,034 (GRCm39) missense probably benign
R8104:Nedd1 UTSW 10 92,527,778 (GRCm39) missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8226:Nedd1 UTSW 10 92,527,797 (GRCm39) missense probably benign
R8925:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
R8927:Nedd1 UTSW 10 92,558,258 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAACCTAAGGACGCTCGATGC -3'
(R):5'- CGCCTGTTGTCAACAAGTGC -3'

Sequencing Primer
(F):5'- CGCTTACCTGTAGTTGAGGAGCC -3'
(R):5'- CACGTTATGTTTAAGGTGCTTGC -3'
Posted On 2019-05-13