Mutagenetix > Incidental Mutation

Incidental Mutation 'R7011:Dhx8'

545036

Institutional Source

Beutler Lab

Gene Symbol

Dhx8

Ensembl Gene

ENSMUSG00000034931

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 8

Synonyms

RNA helicase, Ddx8, mDEAH6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R7011 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101732919-101767358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101741520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 435 (L435P)

Ref Sequence

ENSEMBL: ENSMUSP00000037251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]

AlphaFold

A2A4P0

Predicted Effect

probably damaging
Transcript: ENSMUST00000039152
AA Change: L435P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: L435P

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	168	240	N/A	INTRINSIC
low complexity region	244	254	N/A	INTRINSIC
S1	287	360	3.52e-18	SMART
low complexity region	453	469	N/A	INTRINSIC
coiled coil region	496	525	N/A	INTRINSIC
DEXDc	587	771	7.26e-33	SMART
HELICc	815	919	7.45e-21	SMART
HA2	980	1070	1.34e-38	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: L382P

Domain	Start	End	E-Value	Type
low complexity region	2	8	N/A	INTRINSIC
low complexity region	115	187	N/A	INTRINSIC
low complexity region	191	201	N/A	INTRINSIC
S1	234	307	3.52e-18	SMART
low complexity region	400	416	N/A	INTRINSIC
coiled coil region	443	472	N/A	INTRINSIC
DEXDc	534	718	7.26e-33	SMART
HELICc	762	866	7.45e-21	SMART
HA2	927	1017	1.34e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	C	T	11: 46,143,018	P886S	probably benign	Het
Anapc1	C	T	2: 128,648,681		probably null	Het
Ankrd34c	C	A	9: 89,728,948	G447*	probably null	Het
Apbb1ip	A	T	2: 22,835,931	E238D	probably damaging	Het
Arfgap1	T	C	2: 180,972,142	L110P	probably damaging	Het
Arhgap21	G	A	2: 20,848,878	T1901I	possibly damaging	Het
Brpf1	C	A	6: 113,318,466	Q679K	probably benign	Het
Btnl2	A	G	17: 34,363,513	E351G	probably damaging	Het
Cd209f	T	A	8: 4,104,859	T80S	probably benign	Het
Cdc16	A	G	8: 13,769,451	E349G	probably damaging	Het
Cfap53	A	T	18: 74,329,493	D436V	probably benign	Het
Crhr2	A	T	6: 55,099,210		probably null	Het
Cux1	T	C	5: 136,360,033	K226E	probably damaging	Het
Ddr2	A	T	1: 169,982,103	D768E	probably damaging	Het
Dnah11	AGGCC	AGGCCGGCC	12: 117,922,018		probably null	Het
Eif4ebp1	G	A	8: 27,273,344	R55Q	probably damaging	Het
Fbxo18	T	A	2: 11,762,963	D358V	probably damaging	Het
Fra10ac1	T	A	19: 38,188,794	E304D	probably benign	Het
Gabrb2	T	C	11: 42,626,661	S399P	possibly damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gprin2	G	T	14: 34,195,436	H126N	probably null	Het
Gucy1a1	A	G	3: 82,109,115	S189P	probably damaging	Het
Htr1d	T	C	4: 136,443,006	M182T	probably benign	Het
Lipc	A	G	9: 70,818,954	F73L	probably benign	Het
Liph	A	G	16: 21,984,097	I74T	probably damaging	Het
Lrif1	T	G	3: 106,732,285	Y229D	probably damaging	Het
Magel2	C	T	7: 62,378,533	T395I	possibly damaging	Het
Magi3	T	C	3: 104,105,754	N139S	probably damaging	Het
Man2c1	T	A	9: 57,137,833	V336E	probably damaging	Het
Mapk12	A	T	15: 89,135,600	Y135N	probably damaging	Het
Mapkapk3	C	T	9: 107,289,396		probably benign	Het
Mast1	A	T	8: 84,911,945	Y653*	probably null	Het
Muc16	T	A	9: 18,637,451	I5849F	probably benign	Het
Muc16	T	A	9: 18,637,543	H5818L	probably benign	Het
Ndufa10	A	G	1: 92,470,859	S68P	probably damaging	Het
Nedd1	C	A	10: 92,690,773	L503F	probably benign	Het
Nr1i3	A	G	1: 171,214,358	M4V	probably benign	Het
Olfr1121	G	A	2: 87,372,260	A243T	possibly damaging	Het
Olfr1307	A	T	2: 111,944,686	F257I	probably benign	Het
Olfr1501	T	C	19: 13,839,039	I45V	probably benign	Het
Olfr332	T	A	11: 58,490,144	I204F	possibly damaging	Het
Papd7	C	T	13: 69,500,080	G489S	probably damaging	Het
Pcdh18	A	T	3: 49,754,782	S695T	probably benign	Het
Pcdha1	T	C	18: 36,930,535	I84T	probably damaging	Het
Plek	T	A	11: 16,994,760	D90V	possibly damaging	Het
Ppp6r1	A	G	7: 4,646,826	C47R	probably damaging	Het
Psg27	G	C	7: 18,556,873	N468K	probably benign	Het
Ptchd4	G	A	17: 42,503,868	E887K	probably benign	Het
Rabgap1	C	T	2: 37,540,480	L678F	probably damaging	Het
Rmdn3	T	C	2: 119,138,423	Y429C	probably damaging	Het
Ros1	A	T	10: 52,180,176	C73S	probably damaging	Het
Rtkn2	G	A	10: 67,979,665		probably benign	Het
Slc25a42	A	G	8: 70,186,702	S242P	probably damaging	Het
Smtnl1	T	A	2: 84,818,409	D167V	probably benign	Het
Smurf2	A	G	11: 106,833,784	L511P	probably benign	Het
Stbd1	A	T	5: 92,605,118	K156*	probably null	Het
Tenm4	G	T	7: 96,896,135	G2453*	probably null	Het
Tpr	A	G	1: 150,433,772	K1760E	probably damaging	Het
Triobp	T	A	15: 78,978,723	L1427Q	probably damaging	Het
Uaca	A	G	9: 60,870,368	E679G	probably damaging	Het
Ucn3	T	G	13: 3,941,421	H77P	possibly damaging	Het
Wnk2	T	A	13: 49,071,091	D998V	probably damaging	Het
Xrcc3	A	G	12: 111,804,535	V320A	probably damaging	Het
Zdbf2	A	G	1: 63,306,766	T1435A	possibly damaging	Het
Zfp36l2	G	T	17: 84,186,433	H259N	possibly damaging	Het
Zfp619	A	T	7: 39,537,762	H1072L	probably damaging	Het
Zfy2	T	A	Y: 2,107,127	E502D	possibly damaging	Het
Zfyve16	G	A	13: 92,521,987	P472L	probably benign	Het

Other mutations in Dhx8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01922:Dhx8	APN	11	101739807	missense	probably damaging	0.99
IGL01957:Dhx8	APN	11	101754826	missense	possibly damaging	0.48
IGL02039:Dhx8	APN	11	101764027	critical splice donor site	probably null
IGL02115:Dhx8	APN	11	101752388	missense	probably damaging	1.00
IGL02161:Dhx8	APN	11	101757606	missense	probably damaging	1.00
IGL02691:Dhx8	APN	11	101752004	splice site	probably benign
IGL02697:Dhx8	APN	11	101754781	missense	probably damaging	1.00
FR4304:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4342:Dhx8	UTSW	11	101738206	frame shift	probably null
FR4449:Dhx8	UTSW	11	101738184	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738190	small deletion	probably benign
FR4449:Dhx8	UTSW	11	101738194	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738206	small insertion	probably benign
FR4449:Dhx8	UTSW	11	101738207	small insertion	probably benign
FR4589:Dhx8	UTSW	11	101738188	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738179	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738182	small insertion	probably benign
FR4737:Dhx8	UTSW	11	101738189	small insertion	probably benign
R0402:Dhx8	UTSW	11	101752397	missense	probably damaging	1.00
R0525:Dhx8	UTSW	11	101763928	missense	probably damaging	1.00
R0969:Dhx8	UTSW	11	101739700	splice site	probably benign
R1497:Dhx8	UTSW	11	101735387	intron	probably benign
R1576:Dhx8	UTSW	11	101752319	missense	probably damaging	1.00
R1758:Dhx8	UTSW	11	101766738	missense	probably damaging	1.00
R1773:Dhx8	UTSW	11	101752363	missense	possibly damaging	0.87
R1941:Dhx8	UTSW	11	101752198	critical splice donor site	probably null
R1954:Dhx8	UTSW	11	101753279	missense	probably damaging	0.98
R2124:Dhx8	UTSW	11	101762245	missense	probably damaging	0.99
R2128:Dhx8	UTSW	11	101738409	missense	probably benign	0.06
R2148:Dhx8	UTSW	11	101738377	nonsense	probably null
R2206:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R2207:Dhx8	UTSW	11	101750971	missense	probably benign	0.03
R4667:Dhx8	UTSW	11	101738161	missense	unknown
R4678:Dhx8	UTSW	11	101739808	missense	probably damaging	1.00
R4825:Dhx8	UTSW	11	101738170	nonsense	probably null
R4943:Dhx8	UTSW	11	101737700	nonsense	probably null
R5341:Dhx8	UTSW	11	101738190	small deletion	probably benign
R5586:Dhx8	UTSW	11	101733036	unclassified	probably benign
R5662:Dhx8	UTSW	11	101766758	missense	possibly damaging	0.89
R5664:Dhx8	UTSW	11	101740751	missense	probably damaging	1.00
R6082:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6085:Dhx8	UTSW	11	101764313	missense	probably damaging	1.00
R6415:Dhx8	UTSW	11	101737687	missense	unknown
R6658:Dhx8	UTSW	11	101764922	missense	probably damaging	1.00
R6841:Dhx8	UTSW	11	101764792	missense	probably damaging	0.98
R6918:Dhx8	UTSW	11	101738421	nonsense	probably null
R7098:Dhx8	UTSW	11	101737768	critical splice donor site	probably null
R7153:Dhx8	UTSW	11	101740175	splice site	probably null
R7284:Dhx8	UTSW	11	101754822	missense	probably damaging	1.00
R7604:Dhx8	UTSW	11	101764797	missense	probably damaging	1.00
R8135:Dhx8	UTSW	11	101738264	missense	unknown
R8137:Dhx8	UTSW	11	101763982	missense	probably damaging	1.00
R8256:Dhx8	UTSW	11	101740762	missense	possibly damaging	0.93
R8284:Dhx8	UTSW	11	101757629	missense	probably damaging	1.00
R8289:Dhx8	UTSW	11	101740745	missense	probably benign	0.01
R8696:Dhx8	UTSW	11	101733132	missense	unknown
R9061:Dhx8	UTSW	11	101741580	missense	possibly damaging	0.61
R9076:Dhx8	UTSW	11	101738195	missense
R9443:Dhx8	UTSW	11	101764914	missense	probably damaging	1.00
R9492:Dhx8	UTSW	11	101763982	missense	possibly damaging	0.67
R9554:Dhx8	UTSW	11	101754788	nonsense	probably null
R9700:Dhx8	UTSW	11	101733189	critical splice donor site	probably null
R9780:Dhx8	UTSW	11	101741577	missense	possibly damaging	0.73
Z1177:Dhx8	UTSW	11	101757660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGATTGGACATGTGCCTTAC -3'
(R):5'- TGATCTGTCTAAACACGCGC -3'

Sequencing Primer
(F):5'- GATTGGACATGTGCCTTACTCTGAC -3'
(R):5'- ACGCGCTTCTATCCAGAGATGAG -3'

Posted On

2019-05-13