Incidental Mutation 'R7011:Triobp'
ID545047
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7011 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78978723 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1427 (L1427Q)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
Predicted Effect probably benign
Transcript: ENSMUST00000109687
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: L1427Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: L1427Q

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 C T 11: 46,143,018 P886S probably benign Het
Anapc1 C T 2: 128,648,681 probably null Het
Ankrd34c C A 9: 89,728,948 G447* probably null Het
Apbb1ip A T 2: 22,835,931 E238D probably damaging Het
Arfgap1 T C 2: 180,972,142 L110P probably damaging Het
Arhgap21 G A 2: 20,848,878 T1901I possibly damaging Het
Brpf1 C A 6: 113,318,466 Q679K probably benign Het
Btnl2 A G 17: 34,363,513 E351G probably damaging Het
Cd209f T A 8: 4,104,859 T80S probably benign Het
Cdc16 A G 8: 13,769,451 E349G probably damaging Het
Cfap53 A T 18: 74,329,493 D436V probably benign Het
Crhr2 A T 6: 55,099,210 probably null Het
Cux1 T C 5: 136,360,033 K226E probably damaging Het
Ddr2 A T 1: 169,982,103 D768E probably damaging Het
Dhx8 T C 11: 101,741,520 L435P probably damaging Het
Dnah11 AGGCC AGGCCGGCC 12: 117,922,018 probably null Het
Eif4ebp1 G A 8: 27,273,344 R55Q probably damaging Het
Fbxo18 T A 2: 11,762,963 D358V probably damaging Het
Fra10ac1 T A 19: 38,188,794 E304D probably benign Het
Gabrb2 T C 11: 42,626,661 S399P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 G T 14: 34,195,436 H126N probably null Het
Gucy1a1 A G 3: 82,109,115 S189P probably damaging Het
Htr1d T C 4: 136,443,006 M182T probably benign Het
Lipc A G 9: 70,818,954 F73L probably benign Het
Liph A G 16: 21,984,097 I74T probably damaging Het
Lrif1 T G 3: 106,732,285 Y229D probably damaging Het
Magel2 C T 7: 62,378,533 T395I possibly damaging Het
Magi3 T C 3: 104,105,754 N139S probably damaging Het
Man2c1 T A 9: 57,137,833 V336E probably damaging Het
Mapk12 A T 15: 89,135,600 Y135N probably damaging Het
Mapkapk3 C T 9: 107,289,396 probably benign Het
Mast1 A T 8: 84,911,945 Y653* probably null Het
Muc16 T A 9: 18,637,451 I5849F probably benign Het
Muc16 T A 9: 18,637,543 H5818L probably benign Het
Ndufa10 A G 1: 92,470,859 S68P probably damaging Het
Nedd1 C A 10: 92,690,773 L503F probably benign Het
Nr1i3 A G 1: 171,214,358 M4V probably benign Het
Olfr1121 G A 2: 87,372,260 A243T possibly damaging Het
Olfr1307 A T 2: 111,944,686 F257I probably benign Het
Olfr1501 T C 19: 13,839,039 I45V probably benign Het
Olfr332 T A 11: 58,490,144 I204F possibly damaging Het
Papd7 C T 13: 69,500,080 G489S probably damaging Het
Pcdh18 A T 3: 49,754,782 S695T probably benign Het
Pcdha1 T C 18: 36,930,535 I84T probably damaging Het
Plek T A 11: 16,994,760 D90V possibly damaging Het
Ppp6r1 A G 7: 4,646,826 C47R probably damaging Het
Psg27 G C 7: 18,556,873 N468K probably benign Het
Ptchd4 G A 17: 42,503,868 E887K probably benign Het
Rabgap1 C T 2: 37,540,480 L678F probably damaging Het
Rmdn3 T C 2: 119,138,423 Y429C probably damaging Het
Ros1 A T 10: 52,180,176 C73S probably damaging Het
Rtkn2 G A 10: 67,979,665 probably benign Het
Slc25a42 A G 8: 70,186,702 S242P probably damaging Het
Smtnl1 T A 2: 84,818,409 D167V probably benign Het
Smurf2 A G 11: 106,833,784 L511P probably benign Het
Stbd1 A T 5: 92,605,118 K156* probably null Het
Tenm4 G T 7: 96,896,135 G2453* probably null Het
Tpr A G 1: 150,433,772 K1760E probably damaging Het
Uaca A G 9: 60,870,368 E679G probably damaging Het
Ucn3 T G 13: 3,941,421 H77P possibly damaging Het
Wnk2 T A 13: 49,071,091 D998V probably damaging Het
Xrcc3 A G 12: 111,804,535 V320A probably damaging Het
Zdbf2 A G 1: 63,306,766 T1435A possibly damaging Het
Zfp36l2 G T 17: 84,186,433 H259N possibly damaging Het
Zfp619 A T 7: 39,537,762 H1072L probably damaging Het
Zfy2 T A Y: 2,107,127 E502D possibly damaging Het
Zfyve16 G A 13: 92,521,987 P472L probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGGCAGTAGCATAATGGTCAGG -3'
(R):5'- GAGGCAGGAAAGACCATCTC -3'

Sequencing Primer
(F):5'- CATAATGGTCAGGGGAGGCTGTG -3'
(R):5'- GACCATCTCCCAGAGCCTG -3'
Posted On2019-05-13