Incidental Mutation 'R7012:F13b'
ID545059
Institutional Source Beutler Lab
Gene Symbol F13b
Ensembl Gene ENSMUSG00000026368
Gene Namecoagulation factor XIII, beta subunit
SynonymsCf-13b, Cf13b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7012 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139501702-139523752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139516358 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 477 (I477V)
Ref Sequence ENSEMBL: ENSMUSP00000027615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027615]
Predicted Effect probably benign
Transcript: ENSMUST00000027615
AA Change: I477V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: I477V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 26 88 1.26e-7 SMART
CCP 92 147 2.11e-9 SMART
CCP 154 209 9.83e-10 SMART
CCP 214 268 7.62e-16 SMART
CCP 275 328 8.62e-15 SMART
CCP 337 390 4.62e-15 SMART
CCP 397 451 3.5e-15 SMART
Blast:CCP 455 516 1e-28 BLAST
CCP 525 579 2.44e-14 SMART
Blast:CCP 583 647 1e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Adssl1 A G 12: 112,634,236 D213G probably benign Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Muc16 T C 9: 18,495,618 probably null Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Sh3d19 A G 3: 86,085,013 N116S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Vmn2r98 A G 17: 19,066,268 N343D probably benign Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in F13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:F13b APN 1 139510587 missense probably benign 0.01
IGL00937:F13b APN 1 139517360 splice site probably benign
IGL01138:F13b APN 1 139517212 missense probably damaging 0.99
IGL01319:F13b APN 1 139506793 missense probably damaging 0.98
IGL01328:F13b APN 1 139508082 splice site probably benign
IGL01621:F13b APN 1 139503851 missense probably benign 0.00
IGL01843:F13b APN 1 139516427 missense probably damaging 1.00
IGL02153:F13b APN 1 139516377 missense probably damaging 1.00
IGL02192:F13b APN 1 139517333 missense probably damaging 1.00
IGL02555:F13b APN 1 139517186 missense probably damaging 1.00
IGL03036:F13b APN 1 139508115 missense possibly damaging 0.80
IGL03185:F13b APN 1 139516386 missense probably benign 0.03
IGL03303:F13b APN 1 139513036 missense possibly damaging 0.67
IGL03335:F13b APN 1 139522386 missense probably damaging 1.00
IGL03371:F13b APN 1 139506936 missense probably damaging 1.00
R0139:F13b UTSW 1 139508203 missense probably damaging 0.96
R0157:F13b UTSW 1 139503847 missense probably benign
R0381:F13b UTSW 1 139510859 missense probably damaging 0.98
R0492:F13b UTSW 1 139522559 splice site probably null
R0589:F13b UTSW 1 139506933 missense possibly damaging 0.94
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1515:F13b UTSW 1 139510965 missense probably damaging 1.00
R1869:F13b UTSW 1 139510934 missense probably benign 0.44
R2047:F13b UTSW 1 139508223 missense probably damaging 1.00
R2218:F13b UTSW 1 139506844 missense probably benign 0.42
R2878:F13b UTSW 1 139501747 start codon destroyed probably null
R3032:F13b UTSW 1 139517333 missense probably damaging 1.00
R4077:F13b UTSW 1 139501770 missense unknown
R4079:F13b UTSW 1 139501770 missense unknown
R4208:F13b UTSW 1 139516341 missense probably damaging 1.00
R4350:F13b UTSW 1 139516298 missense probably benign 0.00
R4674:F13b UTSW 1 139501804 missense unknown
R4675:F13b UTSW 1 139501804 missense unknown
R4972:F13b UTSW 1 139510923 missense probably damaging 1.00
R5212:F13b UTSW 1 139512987 missense probably benign
R5343:F13b UTSW 1 139510544 missense possibly damaging 0.61
R5503:F13b UTSW 1 139522543 missense probably benign 0.00
R5984:F13b UTSW 1 139508212 missense probably damaging 1.00
R7155:F13b UTSW 1 139508157 missense probably damaging 1.00
R7250:F13b UTSW 1 139516489 critical splice donor site probably null
R7478:F13b UTSW 1 139507695 missense probably benign 0.01
R7779:F13b UTSW 1 139516386 missense probably benign 0.03
R7960:F13b UTSW 1 139503771 nonsense probably null
R8007:F13b UTSW 1 139506942 missense probably benign 0.11
R8043:F13b UTSW 1 139522448 missense probably benign
R8281:F13b UTSW 1 139510951 missense probably benign 0.03
Z1088:F13b UTSW 1 139508202 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCTTCATCTAACATGGATGGGTG -3'
(R):5'- CCGCAGATACTAAGTGAGCAGC -3'

Sequencing Primer
(F):5'- TCTAGACCAGACTGGCCTTG -3'
(R):5'- TACTAAGTGAGCAGCATGTCC -3'
Posted On2019-05-13