Incidental Mutation 'R7012:Ttll9'
ID 545062
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Name tubulin tyrosine ligase-like family, member 9
Synonyms 4930509O20Rik, 1700016F23Rik
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 152804405-152850402 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152844982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 450 (I450T)
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
AlphaFold A2APC3
Predicted Effect probably benign
Transcript: ENSMUST00000099197
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103155
AA Change: I450T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: I450T

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adcy4 C T 14: 56,017,376 (GRCm39) V266I possibly damaging Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Cntn6 T A 6: 104,703,223 (GRCm39) V215E probably damaging Het
Cntn6 A G 6: 104,751,441 (GRCm39) I294V probably benign Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Git1 T C 11: 77,390,606 (GRCm39) L114P probably damaging Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Phlpp2 T A 8: 110,603,486 (GRCm39) F51I possibly damaging Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Tmem132b T A 5: 125,775,654 (GRCm39) L376Q probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152,826,180 (GRCm39) missense probably damaging 0.99
IGL01107:Ttll9 APN 2 152,844,809 (GRCm39) splice site probably benign
IGL01365:Ttll9 APN 2 152,842,054 (GRCm39) missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152,825,025 (GRCm39) missense probably damaging 0.99
IGL02264:Ttll9 APN 2 152,842,055 (GRCm39) missense probably damaging 1.00
IGL02477:Ttll9 APN 2 152,842,117 (GRCm39) missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 152,844,871 (GRCm39) missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
BB011:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
I2288:Ttll9 UTSW 2 152,814,259 (GRCm39) splice site probably benign
R0053:Ttll9 UTSW 2 152,804,426 (GRCm39) utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152,825,054 (GRCm39) missense probably damaging 0.99
R0319:Ttll9 UTSW 2 152,842,018 (GRCm39) splice site probably null
R0388:Ttll9 UTSW 2 152,842,099 (GRCm39) missense probably benign
R0556:Ttll9 UTSW 2 152,815,526 (GRCm39) critical splice donor site probably null
R0689:Ttll9 UTSW 2 152,825,047 (GRCm39) missense probably benign 0.05
R1829:Ttll9 UTSW 2 152,842,156 (GRCm39) missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 152,844,214 (GRCm39) missense probably damaging 1.00
R2144:Ttll9 UTSW 2 152,844,927 (GRCm39) missense probably benign
R2229:Ttll9 UTSW 2 152,824,983 (GRCm39) missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152,826,065 (GRCm39) missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152,825,047 (GRCm39) missense probably benign 0.05
R4191:Ttll9 UTSW 2 152,844,927 (GRCm39) missense probably benign
R4539:Ttll9 UTSW 2 152,836,011 (GRCm39) missense probably damaging 1.00
R4866:Ttll9 UTSW 2 152,844,920 (GRCm39) missense probably benign 0.02
R5115:Ttll9 UTSW 2 152,831,510 (GRCm39) intron probably benign
R5279:Ttll9 UTSW 2 152,804,464 (GRCm39) missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152,833,572 (GRCm39) missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152,826,144 (GRCm39) missense probably benign 0.13
R5417:Ttll9 UTSW 2 152,844,912 (GRCm39) missense probably benign
R5555:Ttll9 UTSW 2 152,832,020 (GRCm39) critical splice donor site probably null
R5574:Ttll9 UTSW 2 152,826,168 (GRCm39) missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152,826,234 (GRCm39) missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152,815,521 (GRCm39) frame shift probably null
R6366:Ttll9 UTSW 2 152,833,525 (GRCm39) missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152,841,261 (GRCm39) missense probably damaging 1.00
R6655:Ttll9 UTSW 2 152,842,223 (GRCm39) splice site probably null
R6657:Ttll9 UTSW 2 152,826,182 (GRCm39) missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152,841,220 (GRCm39) nonsense probably null
R7162:Ttll9 UTSW 2 152,831,523 (GRCm39) missense probably damaging 0.99
R7804:Ttll9 UTSW 2 152,844,278 (GRCm39) critical splice donor site probably null
R7862:Ttll9 UTSW 2 152,848,895 (GRCm39) missense probably benign 0.00
R7924:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
R7998:Ttll9 UTSW 2 152,833,546 (GRCm39) missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 152,844,956 (GRCm39) missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152,836,068 (GRCm39) missense probably benign
R8897:Ttll9 UTSW 2 152,844,841 (GRCm39) missense probably damaging 0.99
R9061:Ttll9 UTSW 2 152,818,113 (GRCm39) missense possibly damaging 0.46
R9667:Ttll9 UTSW 2 152,831,989 (GRCm39) nonsense probably null
R9716:Ttll9 UTSW 2 152,818,136 (GRCm39) missense probably benign 0.00
R9780:Ttll9 UTSW 2 152,836,023 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACCGACTGCATGCTATCTC -3'
(R):5'- CACTATAACAGGCAGGGTCC -3'

Sequencing Primer
(F):5'- GACTGCATGCTATCTCCCCGTC -3'
(R):5'- CCAGGAGTATCCAACCGTTTGATG -3'
Posted On 2019-05-13