Incidental Mutation 'R7012:Sh3d19'
ID545063
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene NameSH3 domain protein D19
SynonymsKryn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7012 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location85971109-86130526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86085013 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000138320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
Predicted Effect probably benign
Transcript: ENSMUST00000107664
AA Change: N116S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: N116S

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182666
AA Change: N116S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: N116S

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Adssl1 A G 12: 112,634,236 D213G probably benign Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
F13b A G 1: 139,516,358 I477V probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Muc16 T C 9: 18,495,618 probably null Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Vmn2r98 A G 17: 19,066,268 N343D probably benign Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86098185 missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86114796 missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86121167 missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86093710 missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86106998 missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86126644 missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86120606 missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86107227 missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 86084776 missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86126688 missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86123713 missense probably benign
R4663:Sh3d19 UTSW 3 86123263 missense probably benign 0.06
R4730:Sh3d19 UTSW 3 86116864 missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86123767 missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86126604 missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86104102 missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 86085336 missense probably benign
R6806:Sh3d19 UTSW 3 86104333 missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 86084911 missense probably benign 0.03
R7147:Sh3d19 UTSW 3 86104277 missense possibly damaging 0.71
R7367:Sh3d19 UTSW 3 86104228 missense probably benign 0.21
R7590:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R7739:Sh3d19 UTSW 3 86123731 missense probably benign
X0027:Sh3d19 UTSW 3 86120703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTATTCCCCGCACGATTC -3'
(R):5'- TGATGCTACTGAGAGTCGGG -3'

Sequencing Primer
(F):5'- GAAGCCTGCTGTTTCCTCAGG -3'
(R):5'- GGCGGGGCAGAAACCAG -3'
Posted On2019-05-13