Incidental Mutation 'R7012:Tmem132b'
ID 545069
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Name transmembrane protein 132B
Synonyms
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125609449-125869647 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125775654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 376 (L376Q)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
AlphaFold F7BAB2
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: L376Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: L376Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adcy4 C T 14: 56,017,376 (GRCm39) V266I possibly damaging Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Cntn6 T A 6: 104,703,223 (GRCm39) V215E probably damaging Het
Cntn6 A G 6: 104,751,441 (GRCm39) I294V probably benign Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Git1 T C 11: 77,390,606 (GRCm39) L114P probably damaging Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Phlpp2 T A 8: 110,603,486 (GRCm39) F51I possibly damaging Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Ttll9 T C 2: 152,844,982 (GRCm39) I450T possibly damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125,775,792 (GRCm39) missense probably benign
IGL01518:Tmem132b APN 5 125,855,855 (GRCm39) missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125,699,558 (GRCm39) missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125,864,639 (GRCm39) missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125,855,791 (GRCm39) missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125,864,611 (GRCm39) missense probably damaging 0.99
R0456:Tmem132b UTSW 5 125,864,788 (GRCm39) missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125,862,990 (GRCm39) missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125,860,485 (GRCm39) missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125,860,606 (GRCm39) missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125,864,083 (GRCm39) missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125,715,313 (GRCm39) missense probably benign 0.01
R1689:Tmem132b UTSW 5 125,864,678 (GRCm39) missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125,855,908 (GRCm39) critical splice donor site probably null
R1835:Tmem132b UTSW 5 125,862,963 (GRCm39) missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125,700,080 (GRCm39) missense probably benign
R2033:Tmem132b UTSW 5 125,826,353 (GRCm39) missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125,715,272 (GRCm39) missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R3807:Tmem132b UTSW 5 125,864,644 (GRCm39) missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125,860,497 (GRCm39) missense probably benign
R5149:Tmem132b UTSW 5 125,699,989 (GRCm39) missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125,864,797 (GRCm39) missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125,700,416 (GRCm39) missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125,699,710 (GRCm39) missense probably benign 0.04
R5775:Tmem132b UTSW 5 125,715,394 (GRCm39) critical splice donor site probably null
R7142:Tmem132b UTSW 5 125,699,737 (GRCm39) missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125,864,710 (GRCm39) missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125,864,555 (GRCm39) missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R7650:Tmem132b UTSW 5 125,864,074 (GRCm39) missense probably benign 0.04
R8111:Tmem132b UTSW 5 125,699,857 (GRCm39) missense probably benign 0.00
R8326:Tmem132b UTSW 5 125,864,618 (GRCm39) missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125,715,380 (GRCm39) missense probably benign 0.01
R8900:Tmem132b UTSW 5 125,855,884 (GRCm39) missense probably damaging 0.96
R9147:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9148:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9179:Tmem132b UTSW 5 125,700,115 (GRCm39) missense probably benign 0.02
R9215:Tmem132b UTSW 5 125,864,180 (GRCm39) missense probably damaging 0.99
R9231:Tmem132b UTSW 5 125,860,531 (GRCm39) missense probably damaging 1.00
R9284:Tmem132b UTSW 5 125,864,711 (GRCm39) missense possibly damaging 0.67
R9311:Tmem132b UTSW 5 125,863,029 (GRCm39) missense possibly damaging 0.56
R9436:Tmem132b UTSW 5 125,775,633 (GRCm39) missense possibly damaging 0.53
R9484:Tmem132b UTSW 5 125,860,420 (GRCm39) missense probably damaging 0.98
R9775:Tmem132b UTSW 5 125,864,566 (GRCm39) missense probably benign 0.07
Z1176:Tmem132b UTSW 5 125,864,950 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCGGAAACTCAATAAAGAGCATTTC -3'
(R):5'- TCCTTACCATGGTGAGAGGG -3'

Sequencing Primer
(F):5'- CTTTAGGGAAGGGTTGCACACC -3'
(R):5'- CCTTACCATGGTGAGAGGGACAATG -3'
Posted On 2019-05-13