Incidental Mutation 'R7012:Cntn6'
ID 545072
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 104469751-104840367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104703223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 215 (V215E)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably damaging
Transcript: ENSMUST00000089215
AA Change: V215E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: V215E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161070
AA Change: V143E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: V143E

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162872
AA Change: V215E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: V215E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adcy4 C T 14: 56,017,376 (GRCm39) V266I possibly damaging Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Git1 T C 11: 77,390,606 (GRCm39) L114P probably damaging Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Phlpp2 T A 8: 110,603,486 (GRCm39) F51I possibly damaging Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Tmem132b T A 5: 125,775,654 (GRCm39) L376Q probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Ttll9 T C 2: 152,844,982 (GRCm39) I450T possibly damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104,627,361 (GRCm39) missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104,751,484 (GRCm39) missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104,705,335 (GRCm39) splice site probably benign
IGL02028:Cntn6 APN 6 104,836,387 (GRCm39) missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104,823,103 (GRCm39) critical splice donor site probably null
IGL02557:Cntn6 APN 6 104,751,496 (GRCm39) missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104,781,347 (GRCm39) missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104,781,299 (GRCm39) missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104,753,418 (GRCm39) splice site probably benign
PIT4366001:Cntn6 UTSW 6 104,809,498 (GRCm39) missense probably benign 0.05
R0490:Cntn6 UTSW 6 104,810,879 (GRCm39) missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104,753,275 (GRCm39) missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104,840,109 (GRCm39) missense probably benign 0.00
R0654:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R0960:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R1241:Cntn6 UTSW 6 104,809,470 (GRCm39) missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104,838,861 (GRCm39) missense probably benign 0.07
R1401:Cntn6 UTSW 6 104,781,359 (GRCm39) missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R1542:Cntn6 UTSW 6 104,825,061 (GRCm39) missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104,809,541 (GRCm39) missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104,838,783 (GRCm39) nonsense probably null
R2097:Cntn6 UTSW 6 104,838,910 (GRCm39) missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104,545,989 (GRCm39) start gained probably benign
R2429:Cntn6 UTSW 6 104,627,526 (GRCm39) missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104,703,198 (GRCm39) missense probably benign 0.04
R4009:Cntn6 UTSW 6 104,810,783 (GRCm39) missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104,749,522 (GRCm39) missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4666:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4701:Cntn6 UTSW 6 104,781,321 (GRCm39) missense probably benign 0.01
R4780:Cntn6 UTSW 6 104,822,745 (GRCm39) missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104,836,436 (GRCm39) missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104,751,435 (GRCm39) missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104,749,558 (GRCm39) missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104,809,991 (GRCm39) missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104,546,074 (GRCm39) intron probably benign
R5291:Cntn6 UTSW 6 104,703,096 (GRCm39) missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104,809,523 (GRCm39) missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104,812,706 (GRCm39) missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104,810,064 (GRCm39) missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104,744,851 (GRCm39) missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104,703,100 (GRCm39) missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104,627,461 (GRCm39) missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104,836,409 (GRCm39) missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104,838,907 (GRCm39) missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104,822,719 (GRCm39) frame shift probably null
R7012:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R7337:Cntn6 UTSW 6 104,627,491 (GRCm39) missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104,627,444 (GRCm39) missense probably benign 0.29
R8133:Cntn6 UTSW 6 104,705,298 (GRCm39) missense probably benign 0.19
R8463:Cntn6 UTSW 6 104,749,580 (GRCm39) missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably benign 0.05
R9232:Cntn6 UTSW 6 104,815,781 (GRCm39) missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104,809,471 (GRCm39) missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104,781,308 (GRCm39) missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104,810,044 (GRCm39) nonsense probably null
X0020:Cntn6 UTSW 6 104,744,845 (GRCm39) missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104,809,545 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTTCAATGATAGCCCTTTG -3'
(R):5'- GCCCAGAAACATGTAAATTGTACC -3'

Sequencing Primer
(F):5'- CCCTTTGTATGTTCAAGAGGACAAGC -3'
(R):5'- ACCTGCCCACAATGTAAG -3'
Posted On 2019-05-13