Mutagenetix > Incidental Mutation

Incidental Mutation 'R7012:Cntn6'

545073

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R7012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104774480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 294 (I294V)

Ref Sequence

ENSEMBL: ENSMUSP00000124714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably benign
Transcript: ENSMUST00000089215
AA Change: I366V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I366V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070
AA Change: I294V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I294V

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162872
AA Change: I366V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I366V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,612,087	F686L	probably benign	Het
Adcy4	C	T	14: 55,779,919	V266I	possibly damaging	Het
Adgrb1	A	G	15: 74,529,901	T249A	probably damaging	Het
Adssl1	A	G	12: 112,634,236	D213G	probably benign	Het
Ap1b1	T	G	11: 5,030,963	V453G	probably damaging	Het
Apold1	G	A	6: 134,984,044	G154R	probably damaging	Het
Birc5	A	G	11: 117,849,436	E29G	probably benign	Het
Clcn1	G	A	6: 42,290,608	R75H	probably benign	Het
Cngb1	T	A	8: 95,257,955	I868F	possibly damaging	Het
Col6a2	A	T	10: 76,614,677	I140N	possibly damaging	Het
Cops5	A	G	1: 10,030,665	*147Q	probably null	Het
Dbr1	T	A	9: 99,583,321	Y317*	probably null	Het
Dock5	A	C	14: 67,822,586	V468G	probably damaging	Het
F13b	A	G	1: 139,516,358	I477V	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Git1	T	C	11: 77,499,780	L114P	probably damaging	Het
Greb1l	G	T	18: 10,529,707		probably null	Het
Itih4	A	G	14: 30,890,749	N244S	probably benign	Het
Lin28a	A	G	4: 134,018,729	S5P	probably damaging	Het
Lipt1	T	C	1: 37,875,979	I372T	probably benign	Het
Lysmd4	A	G	7: 67,226,017	T143A	probably benign	Het
Muc16	T	C	9: 18,495,618		probably null	Het
Olfr1101	A	T	2: 86,988,707	H156Q	possibly damaging	Het
Olfr1393	A	T	11: 49,280,996	M283L	probably benign	Het
Olfr271-ps1	A	G	4: 52,936,193	L30P	probably damaging	Het
Olfr49	A	G	14: 54,282,217	I226T	possibly damaging	Het
Pclo	G	A	5: 14,750,479	G4438D	unknown	Het
Phlpp2	T	A	8: 109,876,854	F51I	possibly damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rxfp2	T	C	5: 150,081,194	V711A	probably benign	Het
Sbno2	A	T	10: 80,069,518		probably benign	Het
Setd2	T	A	9: 110,547,683	S189T	probably damaging	Het
Sez6	A	G	11: 77,977,795	N965S	probably benign	Het
Sh3d19	A	G	3: 86,085,013	N116S	probably benign	Het
Slc43a3	T	C	2: 84,946,969	Y221H	probably damaging	Het
Slco1a6	T	C	6: 142,086,561	I613V	probably benign	Het
Stag3	T	A	5: 138,297,609		probably null	Het
Ston1	T	C	17: 88,635,985	M273T	probably damaging	Het
Tbc1d32	A	T	10: 56,224,724	Y53N	probably damaging	Het
Tmem132b	T	A	5: 125,698,590	L376Q	probably damaging	Het
Trim60	A	G	8: 65,000,391	V402A	possibly damaging	Het
Tssk5	A	C	15: 76,373,545	N178K	probably damaging	Het
Ttll9	T	C	2: 153,003,062	I450T	possibly damaging	Het
Tyw1	T	G	5: 130,277,730		probably null	Het
Usp16	T	C	16: 87,458,744		probably null	Het
Vmn2r97	T	C	17: 18,947,494	V670A	probably damaging	Het
Vmn2r98	A	G	17: 19,066,268	N343D	probably benign	Het
Zfp472	T	G	17: 32,977,246	N98K	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTAACATCGATACTTCTGGCC -3'
(R):5'- GTTCACAGGAAAATATCAGGTTCAG -3'

Sequencing Primer
(F):5'- CGATACTTCTGGCCAAAAACTTG -3'
(R):5'- CAGGTTCAGATCTTGTAAAAGTGAC -3'

Posted On

2019-05-13