Mutagenetix > Incidental Mutations

Incidental Mutation 'R7012:Cngb1'

545078

Institutional Source

Beutler Lab

Gene Symbol

Cngb1

Ensembl Gene

ENSMUSG00000031789

Gene Name

cyclic nucleotide gated channel beta 1

Synonyms

BC016201, Cngb1b, Cngb1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95239045-95306585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95257955 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 868 (I868F)

Ref Sequence

ENSEMBL: ENSMUSP00000113827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119870] [ENSMUST00000120044] [ENSMUST00000121162]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119870
AA Change: I868F

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: I868F

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
Pfam:Ion_trans	83	315	9.8e-17	PFAM
cNMP	389	508	4.1e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000113750
Gene: ENSMUSG00000031789
AA Change: I409F

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000112437
Gene: ENSMUSG00000031789
AA Change: I409F

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Meta Mutation Damage Score

0.4905

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (49/49)

MGI Phenotype

PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,612,087	F686L	probably benign	Het
Adcy4	C	T	14: 55,779,919	V266I	possibly damaging	Het
Adgrb1	A	G	15: 74,529,901	T249A	probably damaging	Het
Adssl1	A	G	12: 112,634,236	D213G	probably benign	Het
Ap1b1	T	G	11: 5,030,963	V453G	probably damaging	Het
Apold1	G	A	6: 134,984,044	G154R	probably damaging	Het
Birc5	A	G	11: 117,849,436	E29G	probably benign	Het
Clcn1	G	A	6: 42,290,608	R75H	probably benign	Het
Cntn6	T	A	6: 104,726,262	V215E	probably damaging	Het
Cntn6	A	G	6: 104,774,480	I294V	probably benign	Het
Col6a2	A	T	10: 76,614,677	I140N	possibly damaging	Het
Cops5	A	G	1: 10,030,665	*147Q	probably null	Het
Dbr1	T	A	9: 99,583,321	Y317*	probably null	Het
Dock5	A	C	14: 67,822,586	V468G	probably damaging	Het
F13b	A	G	1: 139,516,358	I477V	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Git1	T	C	11: 77,499,780	L114P	probably damaging	Het
Greb1l	G	T	18: 10,529,707		probably null	Het
Itih4	A	G	14: 30,890,749	N244S	probably benign	Het
Lin28a	A	G	4: 134,018,729	S5P	probably damaging	Het
Lipt1	T	C	1: 37,875,979	I372T	probably benign	Het
Lysmd4	A	G	7: 67,226,017	T143A	probably benign	Het
Muc16	T	C	9: 18,495,618		probably null	Het
Olfr1101	A	T	2: 86,988,707	H156Q	possibly damaging	Het
Olfr1393	A	T	11: 49,280,996	M283L	probably benign	Het
Olfr271-ps1	A	G	4: 52,936,193	L30P	probably damaging	Het
Olfr49	A	G	14: 54,282,217	I226T	possibly damaging	Het
Pclo	G	A	5: 14,750,479	G4438D	unknown	Het
Phlpp2	T	A	8: 109,876,854	F51I	possibly damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rxfp2	T	C	5: 150,081,194	V711A	probably benign	Het
Sbno2	A	T	10: 80,069,518		probably benign	Het
Setd2	T	A	9: 110,547,683	S189T	probably damaging	Het
Sez6	A	G	11: 77,977,795	N965S	probably benign	Het
Sh3d19	A	G	3: 86,085,013	N116S	probably benign	Het
Slc43a3	T	C	2: 84,946,969	Y221H	probably damaging	Het
Slco1a6	T	C	6: 142,086,561	I613V	probably benign	Het
Stag3	T	A	5: 138,297,609		probably null	Het
Ston1	T	C	17: 88,635,985	M273T	probably damaging	Het
Tbc1d32	A	T	10: 56,224,724	Y53N	probably damaging	Het
Tmem132b	T	A	5: 125,698,590	L376Q	probably damaging	Het
Trim60	A	G	8: 65,000,391	V402A	possibly damaging	Het
Tssk5	A	C	15: 76,373,545	N178K	probably damaging	Het
Ttll9	T	C	2: 153,003,062	I450T	possibly damaging	Het
Tyw1	T	G	5: 130,277,730		probably null	Het
Usp16	T	C	16: 87,458,744		probably null	Het
Vmn2r97	T	C	17: 18,947,494	V670A	probably damaging	Het
Vmn2r98	A	G	17: 19,066,268	N343D	probably benign	Het
Zfp472	T	G	17: 32,977,246	N98K	probably benign	Het

Other mutations in Cngb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cngb1	APN	8	95242184	splice site	probably benign
IGL01575:Cngb1	APN	8	95264520	missense	possibly damaging	0.51
IGL02329:Cngb1	APN	8	95242359	missense	probably benign	0.14
IGL03332:Cngb1	APN	8	95298846	splice site	probably benign
IGL03391:Cngb1	APN	8	95303705	unclassified	probably benign
stevie	UTSW	8	95260130	missense	probably damaging	1.00
R0078:Cngb1	UTSW	8	95264545	critical splice acceptor site	probably null
R0116:Cngb1	UTSW	8	95260638	missense	probably damaging	1.00
R1073:Cngb1	UTSW	8	95303567	critical splice donor site	probably null
R1166:Cngb1	UTSW	8	95260181	missense	probably damaging	0.99
R1714:Cngb1	UTSW	8	95257931	missense	probably damaging	1.00
R1753:Cngb1	UTSW	8	95297773	critical splice donor site	probably benign
R1760:Cngb1	UTSW	8	95299700	missense	probably benign	0.03
R1833:Cngb1	UTSW	8	95242355	missense	probably damaging	1.00
R1935:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R1939:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R1940:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R2045:Cngb1	UTSW	8	95297085	splice site	probably null
R2379:Cngb1	UTSW	8	95260130	missense	probably damaging	1.00
R2940:Cngb1	UTSW	8	95252107	missense	probably benign	0.44
R4034:Cngb1	UTSW	8	95264450	missense	possibly damaging	0.47
R4058:Cngb1	UTSW	8	95267654	missense	probably benign	0.00
R4425:Cngb1	UTSW	8	95299716	missense	probably damaging	1.00
R4585:Cngb1	UTSW	8	95297128	critical splice acceptor site	probably null
R4591:Cngb1	UTSW	8	95253384	missense	probably damaging	1.00
R4638:Cngb1	UTSW	8	95266019	missense	probably damaging	1.00
R4906:Cngb1	UTSW	8	95251973	missense	probably damaging	0.96
R4950:Cngb1	UTSW	8	95248507	missense	probably damaging	1.00
R4979:Cngb1	UTSW	8	95259157	missense	probably damaging	0.99
R5148:Cngb1	UTSW	8	95265983	missense	probably benign	0.28
R5474:Cngb1	UTSW	8	95251969	missense	probably damaging	1.00
R5475:Cngb1	UTSW	8	95251969	missense	probably damaging	1.00
R5545:Cngb1	UTSW	8	95252173	missense
R5585:Cngb1	UTSW	8	95263139	missense	probably damaging	1.00
R5637:Cngb1	UTSW	8	95257921	missense	probably damaging	1.00
R5785:Cngb1	UTSW	8	95254195	missense	possibly damaging	0.90
R5967:Cngb1	UTSW	8	95251906	missense	probably damaging	1.00
R6013:Cngb1	UTSW	8	95284321	unclassified	probably benign
R6049:Cngb1	UTSW	8	95270842	missense	probably damaging	0.99
R6370:Cngb1	UTSW	8	95264422	missense	probably benign	0.33
R6377:Cngb1	UTSW	8	95248980	missense	probably damaging	1.00
R6401:Cngb1	UTSW	8	95303739	unclassified	probably benign
R6427:Cngb1	UTSW	8	95297759	intron	probably benign
R6492:Cngb1	UTSW	8	95264424	missense	probably benign	0.01
R6613:Cngb1	UTSW	8	95266010	missense	possibly damaging	0.95
R6721:Cngb1	UTSW	8	95270888	missense	probably benign	0.05
R6919:Cngb1	UTSW	8	95248375	missense	probably null	1.00
R7418:Cngb1	UTSW	8	95278259	nonsense	probably null
R7464:Cngb1	UTSW	8	95254183	missense	possibly damaging	0.92
R7806:Cngb1	UTSW	8	95298804	critical splice donor site	probably null
R8048:Cngb1	UTSW	8	95263210	missense	possibly damaging	0.90
R8074:Cngb1	UTSW	8	95252173	missense
R8189:Cngb1	UTSW	8	95303620	unclassified	probably benign
R8245:Cngb1	UTSW	8	95297780	missense	unknown
R8286:Cngb1	UTSW	8	95275624	missense
RF010:Cngb1	UTSW	8	95303650	frame shift	probably null
RF053:Cngb1	UTSW	8	95303648	frame shift	probably null
T0722:Cngb1	UTSW	8	95296650	missense	probably benign	0.02
T0722:Cngb1	UTSW	8	95297819	missense	probably damaging	0.99
T0722:Cngb1	UTSW	8	95303696	unclassified	probably benign
T0722:Cngb1	UTSW	8	95303714	unclassified	probably benign
Z1177:Cngb1	UTSW	8	95252136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAACGCAATAGCCATAGGAC -3'
(R):5'- TGGCTGAGACTGGTTATCCAC -3'

Sequencing Primer
(F):5'- GCAATAGCCATAGGACACCTTTCTAG -3'
(R):5'- CACTGATTGGATAACTGGCTGGC -3'

Posted On

2019-05-13