Incidental Mutation 'R7012:Phlpp2'
ID 545079
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110603486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 51 (F51I)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect possibly damaging
Transcript: ENSMUST00000034175
AA Change: F16I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: F16I

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179721
AA Change: F51I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: F51I

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adcy4 C T 14: 56,017,376 (GRCm39) V266I possibly damaging Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Cntn6 T A 6: 104,703,223 (GRCm39) V215E probably damaging Het
Cntn6 A G 6: 104,751,441 (GRCm39) I294V probably benign Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Git1 T C 11: 77,390,606 (GRCm39) L114P probably damaging Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Tmem132b T A 5: 125,775,654 (GRCm39) L376Q probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Ttll9 T C 2: 152,844,982 (GRCm39) I450T possibly damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATGGTAGATGGAGGCCTA -3'
(R):5'- TTTCTGACGCTGGTGTCTCTAC -3'

Sequencing Primer
(F):5'- GGCAGACAGTAGCAAAGTTTCCTTC -3'
(R):5'- TGTCTCTACTGTGCAAAGGAC -3'
Posted On 2019-05-13