Incidental Mutation 'R7012:Muc16'
ID545080
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7012 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 18495618 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]
Predicted Effect probably null
Transcript: ENSMUST00000034653
SMART Domains Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564

DomainStartEndE-ValueType
Pfam:SEA 71 174 9.6e-30 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207857
Predicted Effect probably null
Transcript: ENSMUST00000208663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Adssl1 A G 12: 112,634,236 D213G probably benign Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
F13b A G 1: 139,516,358 I477V probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Sh3d19 A G 3: 86,085,013 N116S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Vmn2r98 A G 17: 19,066,268 N343D probably benign Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGCTGAGTCTGACCAATGTGG -3'
(R):5'- GCAGAGAATAGGTTACTGGTGAATTAC -3'

Sequencing Primer
(F):5'- GGTTTATTTATTCTTTGAACCCTGC -3'
(R):5'- GGTTACTGGTGAATTACATGCAATTC -3'
Posted On2019-05-13