Mutagenetix > Incidental Mutations

Incidental Mutation 'R7012:Tbc1d32'

545083

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.882) question?

Stock #

R7012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56224724 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 53 (Y53N)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099739
AA Change: Y53N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: Y53N

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,612,087	F686L	probably benign	Het
Adcy4	C	T	14: 55,779,919	V266I	possibly damaging	Het
Adgrb1	A	G	15: 74,529,901	T249A	probably damaging	Het
Adssl1	A	G	12: 112,634,236	D213G	probably benign	Het
Ap1b1	T	G	11: 5,030,963	V453G	probably damaging	Het
Apold1	G	A	6: 134,984,044	G154R	probably damaging	Het
Birc5	A	G	11: 117,849,436	E29G	probably benign	Het
Clcn1	G	A	6: 42,290,608	R75H	probably benign	Het
Cngb1	T	A	8: 95,257,955	I868F	possibly damaging	Het
Cntn6	T	A	6: 104,726,262	V215E	probably damaging	Het
Cntn6	A	G	6: 104,774,480	I294V	probably benign	Het
Col6a2	A	T	10: 76,614,677	I140N	possibly damaging	Het
Cops5	A	G	1: 10,030,665	*147Q	probably null	Het
Dbr1	T	A	9: 99,583,321	Y317*	probably null	Het
Dock5	A	C	14: 67,822,586	V468G	probably damaging	Het
F13b	A	G	1: 139,516,358	I477V	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Git1	T	C	11: 77,499,780	L114P	probably damaging	Het
Greb1l	G	T	18: 10,529,707		probably null	Het
Itih4	A	G	14: 30,890,749	N244S	probably benign	Het
Lin28a	A	G	4: 134,018,729	S5P	probably damaging	Het
Lipt1	T	C	1: 37,875,979	I372T	probably benign	Het
Lysmd4	A	G	7: 67,226,017	T143A	probably benign	Het
Muc16	T	C	9: 18,495,618		probably null	Het
Olfr1101	A	T	2: 86,988,707	H156Q	possibly damaging	Het
Olfr1393	A	T	11: 49,280,996	M283L	probably benign	Het
Olfr271-ps1	A	G	4: 52,936,193	L30P	probably damaging	Het
Olfr49	A	G	14: 54,282,217	I226T	possibly damaging	Het
Pclo	G	A	5: 14,750,479	G4438D	unknown	Het
Phlpp2	T	A	8: 109,876,854	F51I	possibly damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rxfp2	T	C	5: 150,081,194	V711A	probably benign	Het
Sbno2	A	T	10: 80,069,518		probably benign	Het
Setd2	T	A	9: 110,547,683	S189T	probably damaging	Het
Sez6	A	G	11: 77,977,795	N965S	probably benign	Het
Sh3d19	A	G	3: 86,085,013	N116S	probably benign	Het
Slc43a3	T	C	2: 84,946,969	Y221H	probably damaging	Het
Slco1a6	T	C	6: 142,086,561	I613V	probably benign	Het
Stag3	T	A	5: 138,297,609		probably null	Het
Ston1	T	C	17: 88,635,985	M273T	probably damaging	Het
Tmem132b	T	A	5: 125,698,590	L376Q	probably damaging	Het
Trim60	A	G	8: 65,000,391	V402A	possibly damaging	Het
Tssk5	A	C	15: 76,373,545	N178K	probably damaging	Het
Ttll9	T	C	2: 153,003,062	I450T	possibly damaging	Het
Tyw1	T	G	5: 130,277,730		probably null	Het
Usp16	T	C	16: 87,458,744		probably null	Het
Vmn2r97	T	C	17: 18,947,494	V670A	probably damaging	Het
Vmn2r98	A	G	17: 19,066,268	N343D	probably benign	Het
Zfp472	T	G	17: 32,977,246	N98K	probably benign	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCACAGGTAGGAAGCTAG -3'
(R):5'- GCACTGTATCATGGTTAGTGGC -3'

Sequencing Primer
(F):5'- GAAGACGTACAGAACTGTTATGATC -3'
(R):5'- AGTTTGAGTCCAGCATGAGC -3'

Posted On

2019-05-13