Incidental Mutation 'R7012:Git1'
ID 545088
Institutional Source Beutler Lab
Gene Symbol Git1
Ensembl Gene ENSMUSG00000011877
Gene Name GIT ArfGAP 1
Synonyms p95Cat, Cat-1
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77384388-77398612 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77390606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 114 (L114P)
Ref Sequence ENSEMBL: ENSMUSP00000098375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037285] [ENSMUST00000100812]
AlphaFold Q68FF6
Predicted Effect probably damaging
Transcript: ENSMUST00000037285
AA Change: L114P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037210
Gene: ENSMUSG00000011877
AA Change: L114P

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 273 303 1.01e-10 SMART
GIT 337 367 1.99e-9 SMART
Pfam:GIT_CC 418 483 8.6e-34 PFAM
Pfam:GIT1_C 647 763 3.2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100812
AA Change: L114P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098375
Gene: ENSMUSG00000011877
AA Change: L114P

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 264 294 1.01e-10 SMART
GIT 328 358 1.99e-9 SMART
PDB:2W6A|B 417 473 3e-28 PDB
low complexity region 474 484 N/A INTRINSIC
Pfam:GIT1_C 632 756 4.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality associated with abnormal lung vascular development with surviving mice exhibiting abnormal learning and anxiety related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adcy4 C T 14: 56,017,376 (GRCm39) V266I possibly damaging Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Cntn6 T A 6: 104,703,223 (GRCm39) V215E probably damaging Het
Cntn6 A G 6: 104,751,441 (GRCm39) I294V probably benign Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Phlpp2 T A 8: 110,603,486 (GRCm39) F51I possibly damaging Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Tmem132b T A 5: 125,775,654 (GRCm39) L376Q probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Ttll9 T C 2: 152,844,982 (GRCm39) I450T possibly damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Git1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Git1 APN 11 77,396,783 (GRCm39) missense probably benign
IGL00401:Git1 APN 11 77,389,782 (GRCm39) splice site probably benign
IGL02143:Git1 APN 11 77,396,813 (GRCm39) missense possibly damaging 0.94
IGL02451:Git1 APN 11 77,391,513 (GRCm39) missense possibly damaging 0.66
IGL02474:Git1 APN 11 77,394,217 (GRCm39) missense probably damaging 1.00
IGL02517:Git1 APN 11 77,390,413 (GRCm39) missense probably benign 0.03
IGL02933:Git1 APN 11 77,391,902 (GRCm39) missense probably damaging 0.98
R0148:Git1 UTSW 11 77,396,554 (GRCm39) missense probably benign 0.28
R0195:Git1 UTSW 11 77,391,899 (GRCm39) missense probably benign 0.07
R0762:Git1 UTSW 11 77,390,660 (GRCm39) missense possibly damaging 0.80
R1439:Git1 UTSW 11 77,397,244 (GRCm39) missense possibly damaging 0.89
R1739:Git1 UTSW 11 77,389,808 (GRCm39) missense probably damaging 1.00
R4471:Git1 UTSW 11 77,390,650 (GRCm39) missense probably benign 0.26
R4482:Git1 UTSW 11 77,391,333 (GRCm39) missense possibly damaging 0.89
R4653:Git1 UTSW 11 77,395,869 (GRCm39) missense possibly damaging 0.94
R4783:Git1 UTSW 11 77,390,663 (GRCm39) missense probably damaging 1.00
R5014:Git1 UTSW 11 77,389,821 (GRCm39) missense probably damaging 1.00
R5703:Git1 UTSW 11 77,395,494 (GRCm39) frame shift probably null
R5984:Git1 UTSW 11 77,397,309 (GRCm39) missense possibly damaging 0.76
R6962:Git1 UTSW 11 77,395,469 (GRCm39) missense probably benign 0.31
R6972:Git1 UTSW 11 77,390,347 (GRCm39) missense probably damaging 1.00
R8204:Git1 UTSW 11 77,396,161 (GRCm39) missense probably benign 0.23
R9072:Git1 UTSW 11 77,389,901 (GRCm39) missense probably benign 0.03
R9073:Git1 UTSW 11 77,389,901 (GRCm39) missense probably benign 0.03
R9124:Git1 UTSW 11 77,395,498 (GRCm39) missense possibly damaging 0.69
R9126:Git1 UTSW 11 77,390,380 (GRCm39) missense probably damaging 1.00
R9162:Git1 UTSW 11 77,396,331 (GRCm39) missense probably benign 0.31
R9658:Git1 UTSW 11 77,390,581 (GRCm39) missense probably damaging 1.00
X0028:Git1 UTSW 11 77,389,872 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTTCCCCACAGATGGTG -3'
(R):5'- AATGACACAGCCCCAGAGTG -3'

Sequencing Primer
(F):5'- ACAGATGGTGCACACGCTTG -3'
(R):5'- ACAGCCCCAGAGTGTCTGC -3'
Posted On 2019-05-13