Incidental Mutation 'R7012:Adssl1'
ID545092
Institutional Source Beutler Lab
Gene Symbol Adssl1
Ensembl Gene ENSMUSG00000011148
Gene Nameadenylosuccinate synthetase like 1
SynonymsAdss
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7012 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112620045-112641360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112634236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 213 (D213G)
Ref Sequence ENSEMBL: ENSMUSP00000136572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021726] [ENSMUST00000180015]
Predicted Effect probably benign
Transcript: ENSMUST00000021726
AA Change: D190G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021726
Gene: ENSMUSG00000011148
AA Change: D190G

DomainStartEndE-ValueType
Adenylsucc_synt 33 455 5.9e-259 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180015
AA Change: D213G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136572
Gene: ENSMUSG00000011148
AA Change: D213G

DomainStartEndE-ValueType
Adenylsucc_synt 33 478 2.17e-248 SMART
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
F13b A G 1: 139,516,358 I477V probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Muc16 T C 9: 18,495,618 probably null Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Sh3d19 A G 3: 86,085,013 N116S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Vmn2r98 A G 17: 19,066,268 N343D probably benign Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in Adssl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Adssl1 APN 12 112634736 splice site probably benign
IGL03105:Adssl1 APN 12 112632721 missense probably benign 0.00
barty UTSW 12 112634189 missense probably damaging 1.00
lannister UTSW 12 112634713 missense probably damaging 1.00
R0179:Adssl1 UTSW 12 112632269 missense probably benign 0.11
R1722:Adssl1 UTSW 12 112636481 missense possibly damaging 0.93
R1911:Adssl1 UTSW 12 112633009 missense probably benign
R2877:Adssl1 UTSW 12 112634189 missense probably damaging 1.00
R4829:Adssl1 UTSW 12 112634713 missense probably damaging 1.00
R5155:Adssl1 UTSW 12 112638208 missense probably damaging 1.00
R6225:Adssl1 UTSW 12 112634403 missense probably damaging 0.96
R6247:Adssl1 UTSW 12 112628356 missense probably damaging 1.00
R6873:Adssl1 UTSW 12 112632704 missense probably benign 0.00
R7449:Adssl1 UTSW 12 112634151 missense probably damaging 1.00
R7662:Adssl1 UTSW 12 112639738 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGATTCCTGGACTAGACCGC -3'
(R):5'- GAGCCTTTTGAGTTGACCTTCC -3'

Sequencing Primer
(F):5'- CGGGTCTGCCAGAAGCTG -3'
(R):5'- ACATCTATTTCCAGGGTGGGGAAC -3'
Posted On2019-05-13